Overview

Comprehensive Description

Biology

Common in bays and estuaries often entering rivers. Also found in offshore waters at depths of about 500 m, generally less than 100 m. Feeds mainly on small bony fishes, including wrasses, but also marine snails, squid and shrimp. Viviparous, with 2 to 6 young in a litter. Size at birth about 31 to 39 cm. Utilized salted or frozen for human consumption and processed into fish meal. Not dangerous (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: Caribbean, including the Bahamas, south to Uruguay. The separation of this species from Rhizoprionodon terraenovae whether as a distinct species or a representative of a southern subspecies is still uncertain and pending until detailed studies are commenced.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Wide geographic range from Honduras through Central America, the Caribbean and south to Uruguay in South America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 1100 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

110 cm TL (male/unsexed; (Ref. 5217))
  • Cervigón, F., R. Cipriani, W. Fischer, L. Garibaldi, M. Hendrickx, A.J. Lemus, R. Márquez, J.M. Poutiers, G. Robaina and B. Rodriguez 1992 Fichas FAO de identificación de especies para los fines de la pesca. Guía de campo de las especies comerciales marinas y de aquas salobres de la costa septentrional de Sur América. FAO, Rome. 513 p. Preparado con el financiamento de la Comisión de Comunidades Europeas y de NORAD. (Ref. 5217)   http://www.fishbase.org/references/FBRefSummary.php?id=5217&speccode=7 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; freshwater; brackish; marine; depth range ? - 500 m (Ref. 244), usually ? - 100 m (Ref. 244)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The species is abundant on shallow sandy bottoms mostly in coastal areas and around islands, but has also been recorded in deeper areas. Compagno (in preparation b) noted that it has been found in offshore waters down to 500 m, with one exceptional record far offshore near the surface in water 6,036 m deep. Most studies on this species have been carried out in different areas of Brazil, mainly the northeastern region. Along the Brazilian Coast the species is more abundant in the northern and northeastern coasts, in shallow waters.

The following biological information on the species from Brazil is drawn from Mattos et al. (2001), Mattos et al. (2002) and Montealegre (2002), amongst other references cited in the literature list. Information was obtained from catches taken in shallow coastal waters.

The species is reported to reach a maximum size of ~110 cm TL (Compagno in preparation b). Sexual maturity is attained for females at 65 cm TL and males at 65?70 cm TL which corresponds to ~2 year-old individuals. Growth analyses based on vertebrae indicated that there is a significant difference between sexes with females growing older and larger than males, but males growing faster. Maximum observed age was five years for males and 8eightyears for females, but Mattos et al. (2002) suggest that the species probably reaches ~10 years longevity. Catches obtained off Pernambuco displayed the following population dynamics: natural mortality, M = 0.499; fishing mortality, F = 0.712; total mortality, Z = 1.211; Z0=1.203; Z? = 0.837. Age at maturity and age of recruitment to fisheries coincide. Productivity, estimated according to the methods of Smith et al. (1998) is 0.141, which represents a high resilience to depletion.

Reproduction occurs annually with females ready to copulate immediately after parturition. Many females are ready for mating at any time throughout the year, although there is a peak detected from late winter to early summer. Fecundity is 1?8 embryos, increasing with maternal size. Size at birth is 33 to 37 cm TL. Sex ratio of embryos is significantly biased towards females (1:1.79). The overall post partum catch ratio found by Mattos et al. (2001) was also significantly biased towards females (1:1.57), however, significantly greater male than female immature and maturing individuals indicated sexual and size segregation. Segregation, movements and migrations in this species are not well known and require further study, but Mattos et al (2001) note that females may undergo reproductive migrations into coastal areas in their study area (northern Brazil), while Menni and Lessa (1998) suggest that adults migrate to deeper water in summer and gravid female return to coastal areas in autumn.

Feeds mainly on small teleost fishes and also squid, crabs and prawns (da Silva and da Silva de Almeida (2001).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 14 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 6 - 138
  Temperature range (°C): 18.228 - 27.999
  Nitrate (umol/L): 0.176 - 4.106
  Salinity (PPS): 35.836 - 36.438
  Oxygen (ml/l): 4.037 - 4.995
  Phosphate (umol/l): 0.019 - 0.340
  Silicate (umol/l): 1.630 - 5.484

Graphical representation

Depth range (m): 6 - 138

Temperature range (°C): 18.228 - 27.999

Nitrate (umol/L): 0.176 - 4.106

Salinity (PPS): 35.836 - 36.438

Oxygen (ml/l): 4.037 - 4.995

Phosphate (umol/l): 0.019 - 0.340

Silicate (umol/l): 1.630 - 5.484
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 500m.
Recorded at 500 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Common in bays and estuaries often entering rivers. Also found in offshore waters at depths of about 500 m, generally less than 100 m. Feeds mainly on small bony fishes, including wrasses, but also marine snails, squid and shrimp.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Distinct pairing with embrace (Ref. 205). Viviparous, placental (Ref. 50449).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhizoprionodon porosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACTTAATTTTTGGTGCATGGGCAGGTATAGTTGGAACAGCCCTAAGTCTCCTAATTCGAGCCGAACTCGGTCAACCTGGATCTCTCTTAGGAGATGATCAGATTTATAATGTGATCGTAACTGCCCACGCTTTTGTAATAATCTTCTTTATAGTAATACCAATTATAATTGGTGGCTTCGGAAATTGACTGGTTCCCTTAATAATTGGTGCACCAGATATAGCCTTCCCACGAATAAATAACATGAGCTTTTGACTCCTTCCACCTTCATTCCTTCTTCTCCTAGCTTCTGCTGGAGTAGAAGCTGGAGCAGGTACTGGTTGAACAGTCTATCCCCCATTAGCTAGTAATATAGCTCACGCTGGACCATCTGTTGATCTAGCTATTTTCTCCCTTCATTTAGCCGGTGTTTCATCAATTTTAGCCTCAATTAACTTTATTACAACCATTATTAACATAAAACCACCAGCTATTTCCCAATATCAAACACCTTTATTTGTTTGATCTATTCTTGTAACTACTATTCTCCTTCTCCTTTCACTTCCAGTCCTTGCAGCAGGAATTACAATATTACTTACAGATCGCAACCTTAATACCACATTCTTTGATCCTGCAGGTGGGGGAGACCCAATTCTTTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Rhizoprionodon porosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2006

Assessor/s
Lessa, R., Quijano, S.M., Santana, F.M. & Monzini, J.

Reviewer/s
Cavanagh, R.D. & Kyne, P.M. (Shark Red List Authority)

Justification
Rhizoprionodon porosus is widespread in the Western Central and Southwest Atlantic from Central America, the Caribbean and South America to Uruguay. It is considered a common to abundant species, mostly in coastal areas and around islands on shallow sandy substrates. It has however been found in offshore waters to a depth of 500 m with one exceptional record far offshore near the surface in water 6,036 m deep. The species reaches a maximum size of ~110 cm total length (TL) and biological information for the species is available mainly from Brazil, where it is abundant along the northern and northeastern coasts. The Caribbean sharpnose shark is fast-growing, reaching maturity at a young age (~2 years) and reproduces annually, but with small litters of 1 to 8 pups. Maximum observed ages are five years for males and eight years for females, although it is suggested that the species may reach ~10 years longevity. This species is a common component of landings in directed and incidental fisheries throughout its range, both commercial and artisanal. Fishing effort is increasing in coastal areas of northern Brazil and with declines in the main target species, coastal elasmobranchs (including R. porosus) have been increasingly targeted directly. In Pernambuco, Brazil it has been demonstrated that age at maturity and age of recruitment to fisheries coincide. In Panama, the species is landed in targeted fisheries and from the bycatch of commercial and artisanal fisheries. In Uruguay, the species is more rarely landed, given that it is the southern extent of the species? distribution. No other country specific landing information is available.

The species? widespread distribution and abundance, together with its small size, relatively fast-growth and moderate productivity results in a Least Concern assessment. However, given that coastal artisanal fishing effort is intense (and increasing), certainly in Brazil and other parts of South America, and likely throughout coastal areas of the Caribbean, and that landings have been increasing, the conservation status of this species will need to be monitored. In particular, catch data are required, and stock assessments should be undertaken where the species is fished, thus requiring biological information from outside Brazil. Effective management of coastal fisheries throughout the region is essential for the conservation of this and other species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Abundant. Described as ?one of the commonest, if not the most common, inshore shark where it occurs? (Compagno in preparation b). At the southern end of its distribution in Uruguay, it is more rarely captured (A. Domingo pers. comm).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
This species is a common component of landings in directed and incidental fisheries throughout its range, both commercial and artisanal. It is caught with a wide variety of gear including longlines, benthic trawls, trammelnets, gillnets and hook and line.

In northern Brazil captures include bycatch in coastal fisheries aimed at more economically valuable teleost fishes including Scomberomorus spp., Lutjanus spp., Cynoscion spp. and Mycteroperca spp. (Dias Neto and Dornelles 1996 in Mattos et al. 2001). The species has become the more abundant shark in artisanal landings in this region after the decline in catches of other coastal elasmobranchs (i.e., Carcharhinus porosus). Furthermore, fishing effort is increasing in coastal areas of northern Brazil and with declines in the main target species, coastal elasmobranchs (including R. porosus) have been increasingly targeted directly (Dias Neto and Dornelles 1996 in Mattos et al. 2001). Declines in the sympatric R. lalandii in Brazil demonstrate, even for small relatively productive inshore shark species, the susceptibility to intensive coastal fishing pressure (Rosa et al. 2004).

In Panama the species is landed from targeting and the bycatch of coastal commercial and artisanal fisheries using line and gillnets.

In Uruguay the species is more rarely landed in fisheries, given that it is the southern extent of the species? distribution (A. Domingo, pers. comm).

No other country specific landing information is available, but it is likely the species is facing increasing fishing pressure in the coastal zone over the majority of its distribution. Furthermore, many coastal fishing activities in the region are generally unregulated and unmonitored.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No specific conservation measures in place. Monitoring of catches and landings are a necessity, particularly given that pressure from coastal fisheries is increasing within the species? range. Stock assessments should be undertaken where the species is fished, thus requiring biological information from outside Brazil.

The development and implementation of a national management plan (e.g., under the FAO International Plan of Action for the Conservation and Management of Sharks: IPOA-Sharks) is required to facilitate the conservation and sustainable management of all chondrichthyan species in the region. At the time of writing, Brazil was in the progress of preparing a National Plan of Action (Anon. 2004), which is in urgent need of implementation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Caribbean sharpnose shark

The Caribbean sharpnose shark, Rhizoprionodon porosus, is a requiem shark of the family Carcharhinidae, found in the tropical waters of the western Atlantic Ocean and the Caribbean between latitudes 28° N and 40° S, from the surface to 500 m. Its length is up to about 1.1 m.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!