Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Adults inhabit rocky outcrops and crevices that are frequently situated in sand channels on outer reef slopes. Common in deeper sections of the outer reef about 20 to 60 m in depth (Ref. 7247). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Pacific: anti-equatorial, from the Ryukyu Islands to Taiwan and from Queensland, Australia to New Caledonia. Recently reported from Tonga (Ref. 53797).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 14 - 15; Analspines: 2; Analsoft rays: 15 - 17
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 70 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

7.0 cm SL (male/unsexed; (Ref. 7247))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 20 - 60 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 1 - 43
  Temperature range (°C): 24.353 - 26.269
  Nitrate (umol/L): 0.096 - 0.230
  Salinity (PPS): 35.096 - 35.481
  Oxygen (ml/l): 4.684 - 4.814
  Phosphate (umol/l): 0.108 - 0.173
  Silicate (umol/l): 1.261 - 1.570

Graphical representation

Depth range (m): 1 - 43

Temperature range (°C): 24.353 - 26.269

Nitrate (umol/L): 0.096 - 0.230

Salinity (PPS): 35.096 - 35.481

Oxygen (ml/l): 4.684 - 4.814

Phosphate (umol/l): 0.108 - 0.173

Silicate (umol/l): 1.261 - 1.570
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 20 - 60m.
From 20 to 60 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits rocky outcrops and crevices that are frequently situated in sand channels on outer reef slopes. Common in deeper sections of the outer reef about 20 to 60 m in depth (Ref 7247).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chrysiptera starcki

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTTGGTGCTTGAGCTGGAATAGTAGGCACAGCTTTAAGCCTTCTAATTCGAGCAGAACTAAGCCAACCAGGCGCACTCCTAGGAGACGACCAGATTTATAACGTTATCGTAACCGCACACGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATTTTAATTGGAGGGTTCGGAAACTGATTAATCCCCCTAATGCTCGGGGCCCCCGACATAGCATTCCCTCGAATAAACAATATGAGCTTCTGACTTCTACCCCCATCATTCCTTCTTCTGCTTGCCTCTTCTGGGGTTGAAGCCGGGGCCGGAACAGGTTGAACAGTCTACCCCCCACTATCCGGAAACCTAGCCCATGCCGGAGCGTCCGTAGACCTAACTATCTTCTCCCTTCACCTCGCAGGTGTCTCATCAATTCTAGGGGCAATCAACTTTATTACAACCATTATTAACATAAAACCCCCCGCAATCTCACAATACCAAACCCCCCTATTTGTTTGAGCTGTTCTAATCACCGCCGTTCTTCTCCTCCTTTCTCTCCCAGTTTTAGCCGCCGGTATTACCATGCTTTTAACTGACCGAAATCTAAATACCACCTTCTTCGACCCAGCAGGAGGGGGAGACCCGATTCTCTATCAACATCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chrysiptera starcki

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Chrysiptera starcki

Chrysiptera starcki is a species of damselfish known by the common name Starck's demoiselle. It is native to the western Pacific Ocean, where it has been reported from the Ryukyu Islands and Taiwan to Australia, New Caledonia, and Tonga. It was originally described in 1973 as Abudefduf starcki.[1]

Description[edit]

Starck's demoiselle is blue with a yellow stripe down its back. It grows up to 7 cm in length.[1]

Ecology[edit]

The fish lives around reefs, often in deeper, outer areas, up to 60 metres deep. It lives in crevices in rocky areas. It pairs up to breed and the male guards and tends the eggs.[1] In the wild, Starck's demoiselle will eat plankton (both zooplankton and phytoplankton). [2]

Aquariums[edit]

This is a highly desired fish for a saltwater aquarium. Shallow waters are best for the fish. It can be very colorful if fed the correct diet. The minimum aquarium size is 76 L (20 gal).[3] The tank should be decorated with rocks or gravel and should have many hiding places for the fish. It is not a very aggressive fish, but as it gets bigger it may harass smaller, more passive fish. Two of them together in a tank will fight, however. They are very easy to keep in captivity. They will eat many different types of foods in captivity.[2]

Breeding[edit]

When breeding, males will swim back and forth swiftly flashing their colors to attract females. Males will prepare a territory full of rubble for the female to lay her eggs. Then the male will fertilize them and aggressively defend them from intruders.

References[edit]

  1. ^ a b c Froese, R. and D. Pauly, Eds. Chrysiptera starcki. FishBase. 2011.
  2. ^ a b Animal World
  3. ^ Microcosm Aquarium Explorer


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!