Overview

Comprehensive Description

General Description

From Boulenger 1920, p.11 Hauteur du corps 3 à 3 1/3 fois dans la longueur totale, longueur de la tête 3 ½ à 4 fois. Tête longue comme haute, ou un peu plus longue que haute; museau très court, à profil arrondi, mesurant les 2/3 du diamètre de l'œil, qui est compris 3 1/3 à 3 2/3 fois dans la longueur de la tête et égale la largeur interoculaire; bouche sous le centre de l'œil, sa largeur 1/5 à 1/4 de la longueur de la tête; dents bicuspides, 10 à 12 à la mâchoire supérieure, 20 à 22 à l'inférieure. Dorsale 25-27, commençant au-dessus ou un peu en arrière de l'origine de l'anale; la longueur de sa base 1 2/5 à 1 3/5 fois dans la distance qui la sépare de la tête et à peu près égale à sa distance de la caudale. Anale 26-29, à égale distance de la base de la ventrale et de la caudale. Pectorale pointue, un peu plus courte que la tête, s'étendant bien au delà de la base de la ventrale. Caudale à lobes pointus, écailleuse à la base. Pédicule caudal 3 fois aussi long que haut, mesurant les 2/3 ou les 3/4 de la longueur de la tête. 39 ou 40 écailles le long de la ligne latérale 8-10/10-12 en série transversa1e sur le corps, 10-12/10-12 entre la dorsale et l'anale, 12 autour du pédoncule caudal. Coloration argentée, le dos brun foncé; une tache arrondie noirâtre sous les premiers rayons de la dorsale, qui sont également noirâtres; une bande noirâtre en forme de croissant à la base de la caudale. Longueur totale 110 millimètres.

Description expanded in Lavoué et al (2010) as: Petrocephalus christyi is a medium–sized species within the genus (maximum standard length observed = 100.0 mm). Body ovoid, body 2.7-3.2 longer than high (syntypes = 3.0–3.2) and laterally compressed. Head length between 3.2 and 3.7 times in standard length (syntypes = 3.5–3.7). Snout of intermediate size and round. Eye large (3.1 ≤ Head length/eye diameter ≤ 3.8, syntypes = 3.1–3.8). Mouth small (4.1 ≤ Head length/Head width ≤ 5.5, syntypes = 4.7–5.5), sub–terminal, opening just under the anterior half of the eye. Teeth small and bicuspid, 9–10 in a single row in the upper jaw, 19–21 in the lower jaw. Dorsal and anal fins originate in the posterior half of the body, with pre–dorsal distance equal to pre–anal distance. Dorsal fin with 22–24 branched rays (syntypes = 23–24). Anal fin with 25–27 branched rays (syntypes = 26–27). Scales cover the body, except for the head. Lateral line visible and complete with 35–39 (syntypes = 35–39) pored scales along its length. Thirteen to 15 scales (syntypes = 13–14) between the anterior base of the anal fin and the lateral line. Caudal peduncle relatively thin (2.5 ≤ CPL/CPD ≤ 3.0, syntypes = 2.5–3.0). Twelve scales around the caudal peduncle. Skin on head thick, turning opaque with formalin fixation, with numerous electroreceptors organized into three distinct rosettes. However, the Augenrosette (above the eye) is not as developed as it is in the other species of Petrocephalus exhibiting this rosette.

Body uniformly white–silver, with the presence of two characteristic melanin marks: (1) a distinct round mark below the anterior base (first to fifth rays) of the dorsal fin; (2) a rather diffuse crescent–like mark, centered at the base of the caudal fin and extending onto the upper and lower fleshy lobes of this fin. The fins themselves are translucent.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bulimwengu Walanga, Albert

Source: Africhthy

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Petrocephalus christyi is known from throughout the Congo River basin, including Pool Malebo and adjacent rapids, but it is not found in the Mweru-Luapula-Bangweulu system. It is present in the Lower Guinea region where it is present from the Sanaga River to the Nyong River. It has also been recorded from the Ogowe River.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Africa: Congo River basin (Ref. 3203, 85331).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Endemic to the Congo River basin. The type specimens were collected at the locality Bosabangui along the Lindi River. Petrocephalus christyi is known from several localities in the Congo basin: Odzala, Pool Malebo (Lower Congo), Yangambi region, etc.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lavoué, Sébastien

Source: Africhthy

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

West-central Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal soft rays (total): 24; Analsoft rays: 28 - 29
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 77 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

7.7 cm TL (male/unsexed; (Ref. 11970))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

To 100.0 mm SL

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lavoué, Sébastien

Source: Africhthy

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Petrocephalus christyi is distinguished from all other Petrocephalus species in Central Africa by the following combination of characteristics: dorsal fin with 22-24 branched rays, anal fin with 25-29 branched rays, eye large (HL/ED=3,1-4,2), mouth small, 9-13 teeth in the upper jaw, 17-22 teeth in the lower jaw (Ref. 85331). Melanin pattern consisting of two characteristic black patches: (1) a distinct round mark below the anterior base (first to the fifth rays) of the dorsal fin; and (2) a somewhat diffuse crescent-like mark, centered at the base of the caudal fin and extending onto the fleshy dorsal and ventral lobes of this fin (Ref. 85331).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Petrocephalus christyi is distinguished from all other Petrocephalus species in Central Africa by the following combination of characteristics. Dorsal fin with 22–24 branched rays. Anal fin with 25–29 branched rays. Eye large (Head length/eye diameter ≤ 4.2, range = 3.1–4.2). Mouth small (2.9 ≤ Head length /mouth width, range = 2.9–5.5). Nine to 13 teeth in the upper jaw, 17–22 teeth in the lower jaw. Melanin patterning consisting of two characteristic black patches: (1) a distinct round mark below the anterior base (first to the fifth rays) of the dorsal fin; (2) a somewhat diffuse crescent–like mark, centered at the base of the caudal fin and extending onto the fleshy dorsal and ventral lobes of this fin.

In the small number of individuals recorded so far, the EOD is of normal polarity, four–phasic, with a relatively slow initial rise.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lavoué, Sébastien

Source: Africhthy

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This is a demersal species.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; freshwater; pH range: 5.0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Electric Organ Discharge

EOD of this species does appear to be distinctive. The EOD exhibits normal polarity and is four–phasic with a large, negative–going P2 and smaller peaks, P1, P3 and P4. Similar to the EODs of the Odzala population of P. microphthalmus, a relatively long, slow rise occurs during the initial part of the first head–positive phase in the EODs of both individuals of P. christyi. This rise toward P1 has a shoulder-like inflection point, which at magnified gain is seen to possess a small, negative-going local peak. Both the slow rise and inflection point are subtle features of the EOD; they are only visible in amplified traces. Unlike the EODs of P. microphthalmus, however, those of the two P. christyi individuals possess a prominent head–negative fourth peak (P4), the amplitude of which is 4.5 – 8.6 % of the waveform’s total peak–to–peak swing. A prominent P4 is also present in the EOD emitted by the only individual of Petrocephalus mbossou ever recorded, but otherwise a P4 seems to be rare in Petrocephalus. Based on 1.5% voltage deviations from baseline relative to peak-peak amplitude and at ambient recording temperatures, duration of the EOD is between 0.284 and 0.390 msec in P. christyi, falling in the range of many other Petrocephalus species. Electrocyte anatomy is presumed to be of type NPp based on the EOD waveform, but this has not yet been confirmed histologically.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lavoué, Sébastien

Source: Africhthy

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Evolution

Phylogenetic Relationships

Petrocephalus christyi is the sister group of P. mbossou nested within a large clade of mostly Central Africa endemic species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lavoué, Sébastien

Source: Africhthy

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Petrocephalus christyi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GCTTGAACCGGAATAGCTGGCACTGCACTGAGCCTTCTTATCCGAGCAGAACTAAACCAACCTGGGGCCTTGCTTGGCGACGACCAGATTTATAATGTCATCGTTACTGCACATGCCTTCGTAATAATTTTCTTCATGGTAATACCAATTATAATCGGAGGATTCGGCAACTGACTTATTCCACTTATGCTAGGCGCCCCAGACATGGCGTTCCCCCGAATAAATAACATAAGCTTCTGACTTCTACCCCCATCCTTCCTCCTTCTCCTTGCCTCTTCAGGAGTAGAAGCCGGGGTTGGAACCGGCTGAACGGTTTACCCACCATTAGCCAGTAATTTAGCCCATGCCGGGGCCTCTGTTGACCTAGCCATCTTTTCTCTTCACCTAGCAGGAGTCTCCTCTATTCTAGGGTCAATTAACTTTATCACCACAATTATTAACATAAAACCACCAGCGATTTCCCAATACCAAACCCCACTATTCATCTGATCTCTGCTAGTAACCACAGTACTACTCCTACTTTCCCTACCAGTTCTGGCTGCAGGCATTACTATATTATTAACAGACCGAAACCTAAACACAACATTCTTCGACCCAGCCGGAGGGGGAGACCCAATTCTATACCAGCACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Petrocephalus christyi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Moelants, T.

Reviewer/s
Brummett, R., Mbe Tawe, A.N., Dening Touokong, C., Reid, G.M., Snoeks, J. Staissny, M., Moelants, T., Mamonekene, V., Ndodet, B., Ifuta, S.N.B., Chilala, A., Monsembula, R., Ibala Zamba, A., Opoye Itoua, O., Pouomogne, V., Darwall, W. & Smith, K.

Contributor/s

Justification
The species is widespread without major threats throughout central Africa and is assessed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
No information available.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
None known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
None known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!