Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occurs in rocky or coral-rich areas of deep lagoons, channels and outer reef slopes; usually in or near caves. Juveniles are found in tide pools. Feeds on fish and crustaceans (Ref. 6113). In Hong Kong live fish markets (Ref. 27253).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

General
Epinephelus coeruleopunctatus is widespread throughout the Indo-Pacific and ranges from East Africa south to East London (South Africa) and east to Tonga. It is unknown from the Red Sea, but it does occur in the Persian Gulf. A record from northwestern Australia is doubtful. It is closely related to, and is often confused with, three other white-spotted species: Epinephelus ongus, Epinephelus summana, and Epinephelus corallicola.

Specific
Seychelles (Pittman 1996), Kuwait (Faraj and Al Tamimi 2003), Australia (Northern Territory, New South Wales, Queensland) (Pollard pers. comm.), Indonesia (Sadovy and Liu 2004), Philippines (Russ and Alcala 1996), Thailand (Allen and Stone 2005), Myanmar (Heemstra and Randall 1993), Tonga (Randall et al. 2003), Maldives (Sluka and Reichenbach 1996), New Caledonia (Wantiez and Thollot 2000), Indonesia (Allen pers. comm.) (including Irian Jaya, and all the major island groups), Fiji, Marshall Islands, Micronesia (Pohnpei, Kosrae, Chuuk, Kapingamaringi, Ant), Wake Island, Bonin, Japan (Ryuku, Yaeyama, Kashiwa-jima, Ogasawara) (Myers distributional database 2006, Rhodes and Tupper 2007), Taiwan and Pecadores Islands (Kulbicki pers. comm.), Solomon Islands (Allen pers. comm.), Papua New Guinea (Allen pers. comm.), southern and eastern Africa, Madagascar, Réunion and Mauritius, Lakshadweep and western India, Sri Lanka, the Nicobar Islands, Vanuatu, Loyalty Islands, Gilbert Islands, and Tuvalu.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: East Africa south to East London, South Africa and east to Fiji. Recently recorded from Tonga (Ref. 53797). It is not known from the Red Sea, but it does occur in the Persian Gulf. Record from northwestern Australia (Ref. 3132) is doubtful. It is closely related to, and is often confused with, three other white-spotted species: Epinephelus ongus, Epinephelus summana, and Epinephelus corallicola.
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: East Africa, Madagascar and western Mascarenes east to Marshall Islands, Fiji and Tonga, north to southern Japan, south to Western Australia, northern New South Wales (Australia) and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 15 - 17; Analspines: 3; Analsoft rays: 8
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 760 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

76.0 cm TL (male/unsexed; (Ref. 6492))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
General
Epinephelus coeruleopunctatus is a reef-associated species that occurs in rocky or coral-rich areas of deep lagoons, channels and outer reef slopes; usually in or near caves. It is often found in greater abundances on fringing and intermediate reefs relative to barrier reefs. Whitespotted grouper occurs along mid-shelf reef slopes (GBR) (Newman et al. 1997). Juveniles are found in mangroves and tide pools. In areas where populations assessments have been conducted, the species appears to be generally rare in most reef areas, but appears to prefer outer reef to lagoon areas. E. coeruleopunctatus is reported to be found in caves (among other reef habitats) along the Queensland portion of the Great Barrier Reef.

Feeding
Feeds on fish (10 to 15% of its diet) and crustaceans (up to 70% of its diet).

Reproduction
Although the species is fished through much of its range and there are possible indications of spawning aggregation formation and targeting by fisheries, no information is known of its reproductive biology or general life history, including size at sexual maturity, spawning method or size-age relationships.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 2 - 65 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 0.4 - 6
  Temperature range (°C): 27.060 - 29.325
  Nitrate (umol/L): 0.054 - 0.402
  Salinity (PPS): 34.253 - 34.992
  Oxygen (ml/l): 4.472 - 4.725
  Phosphate (umol/l): 0.143 - 0.222
  Silicate (umol/l): 1.043 - 4.752

Graphical representation

Depth range (m): 0.4 - 6

Temperature range (°C): 27.060 - 29.325

Nitrate (umol/L): 0.054 - 0.402

Salinity (PPS): 34.253 - 34.992

Oxygen (ml/l): 4.472 - 4.725

Phosphate (umol/l): 0.143 - 0.222

Silicate (umol/l): 1.043 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 2 - 65m.
From 2 to 65 meters.

Habitat: reef-associated. Epinephelus caeruleopunctatus - Whitespotted rockcod.  (Bloch, 1790)  Attains 60 cm. Western Indian Ocean south to East London and east to Japan. Australia, Gilbert and Caroline Ids. Coral reefs and rocky bottom in depths of 2 - 20 metres. Stays close to the shelter of caves and crevices.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occur in rocky or coral-rich areas of deep lagoons, channels and outer reef slopes; usually in or near caves. Juveniles are found in tidepools. Feed on fish and crustaceans (Ref. 6113) with main food as benthic invertebrates >2 mm (Ref. 11889).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Epinephelus coeruleopunctatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Epinephelus coeruleopunctatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTCGGCGCCTGAGCCGGAATGGTAGGAACAGCCCTCAGCCTGCTTATTCGAGCCGAGCTTAGCCAACCAGGGGCTCTACTGGGTGACGACCAGATCTATAATGTGATTGTTACAGCACATGCTTTTGTAATAATCTTTTTTATAGTAATACCAATCATGATTGGTGGCTTCGGAAACTGACTCATCCCACTAATAATTGGTGCTCCAGACATGGCATTCCCCCGAATAAATAACATGAGCTTCTGACTTCTCCCCCCATCCTTCCTGCTTCTTCTCGCTTCTTCTGGGGTAGAAGCCGGTGCTGGTACTGGCTGAACAGTTTATCCACCCCTAGCCGGAAACCTAGCCCATGCAGGTGCATCTGTAGACTTAACTATCTTTTCACTACATCTAGCAGGGATCTCATCAATTCTAGGTGCAATCAATTTTATTACAACCATTATTAACATAAAACCCCCAGCCATCTCCCAATACCAAACACCTTTATTTGTATGAGCAGTGTTAATTACAGCGGTGCTTCTGCTCCTCTCTCTTCCTGTTCTTGCCGCCGGTATTACAATGCTACTCACAGATCGCAATCTTAACACCACTTTCTTCGACCCAGCCGGAGGGGGAGACCCCATTCTTTACCAACACTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Rhodes, K., Russell, B., Kulbicki, M., Yeeting, B., Fennessy, S. & Myers, R.

Reviewer/s
Sadovy, Y. & Moss, K. (Grouper and Wrasse Red List Authority)

Contributor/s

Justification
Epinephelus coeruleopunctatus is widespread and ranges from common to rare within its range. Although the species is fished throughout its range, there is no indication of species declines and it occurs in a number of marine protected areas, therefore the species is currently listed as Least Concern. The species is also shown to be a relatively large component of artisinal fisheries and the live reef food fish trade in some areas. Although the species is a target of both artisanal and commercial fisheries, there is a paucity of information on its life history.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
General
Epinephelus coeruleopunctatus is a widespread and occasionally observed species, but never abundant. No information on population trends are available.

Fisheries-dependent data
There is little published information on its population status. The species forms part of artisanal, small-scale (e.g., Rhodes and Tupper 2007) and large-scale commercial fisheries in much of its range and is targeted by the live reef food fish trade (LRFFT) (Sadovy and Liu 2006). It is considered of moderate value within the LRFFT relative to other groupers. In Mozambique, the species provides little to commercialo catch (Instituto de Investigao Pesquiera, Maputo). Rhodes and Tupper (2007) found that the species contributed 13.2% to overall catch volume (as weight) of serranids in Pohnpei (Micronesia), although it was rarely observed during a recent REA (Allen and Stone 2005). E. coeruleopunctatus was more common in catch from outside versus inside reef locales in Pohnpei (Rhodes and Tupper 2007). Indications of spawning aggregation formation were suggested (but not confirmed); targeting by the LRFFT in Indonesia (Sadovy and Liu 2004) and possibly other locales where the fishery is active. In New Caledonia, represents only 0.6% of experimental catch (IRD database). Simiilar densities in Fiji and New Caledonia are reported (50 fish/sq km of reef). Low levels of catch in the line and trap fishery in Mozambique (FRI unpub. data). No males recorded in New Caledonia experimental fishing in mangrove areas and nearshore areas. Mangrove catch was dominated by juveniles (IRD database).

Fisheries-independent data
During dive surveys, along sections of the Great Barrier Reef, Queensland, abundances were relatively low in comparison to other serranids (Pears 2005); also in Indonesia, Papua New Guinea and Solomon Islands (Allen, unpub. data). Rare in the Seychelles and along the Great Barrier Reef (<1/1,000 m²) (Pears 2005).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Overfishing
Although Epinephelus coeruleopunctatus appears to make up a relatively minor component of reef fisheries in areas surveyed and is widely distributed within the Indo-Pacific, the species appears vulnerable to overfishing. In areas where the LRFFT operates, spawning aggregations (if they form) may be vulnerable to extirpation, as shown for other aggregating serranids globally when aggregations are targeted. In other areas, the species may be considered vulnerable to overfishing, including by small-scale commercial fishers, such as those typical of developing islands (e.g. Pohnpei and Palau) (e.g., Rhodes and Tupper 2007).

Habitat Loss
Although the species is found on coral reefs, the effects on populations of coral loss from climate change, pollution or reef destruction from physical forces is unknown. The species appears to prefer certain types of corals (branching or tabular forms). The species may also occur in silty areas associated with coral reefs. The species is on the "species of least concern" list for the Northern Territory, Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Some conservation measures are in place regionally for coral reefs (e.g., Great Barrier Reef Marine Park) and also for serranids (e.g., Pohnpei and Palau) that include marine protected areas, size limits prohibitions on SCUBA-based fishing, destructive fishing gears (Dynamite, poisons) and seasonal closures around reproductive periods, although none are specific for Epinephelus coeruleopunctatus. Population increases seen in areas following declaration of marine protected areas in North Caledonia (Wantiez et al. 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: very high; price reliability: questionable: based on ex-vessel price for species in this genus
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!