Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Smooth hounds are harmless ground sharks. They teeth aren't even sharp, but instead are flat crowned teeth. These teeth are great at finely grinding their food, such as crabs, shellfish and other fish, before swallowing. The number of smooth hounds in the North Sea has increased in the past thirty years, while other shark species have declined in the same period. Smooth hounds are named after their habit to gather in large groups, like a pack of dogs (or hounds).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Found on the continental shelves and uppermost slopes, from the intertidal region to at least 350 m depth (Ref. 244). Collected to depth of 624 m in the eastern Ionian Sea (Ref. 56504). Sometimes in midwater but prefers to swim near the bottom (Ref. 244). Feeds mainly on crustaceans, but also cephalopods and bony fishes (Ref. 244). Viviparous, with a yolk-sac placenta (Ref. 244). Taken by shore and ski-boat anglers (Ref. 5578). Utilized for human consumption, oil, and fishmeal (Ref. 244). Sexual maturity is reached at a length of 70-80 cm (Ref. 35388).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Distribution

Range Description

Distributed from the UK in the Northeast Atlantic, south, including the Mediterranean Sea, Canary Islands, Morocco and south along the western African coast to eastern South Africa (Compagno et al. 2005, Serena 2005, Whitehead et al. 1984).

Northeast Atlantic: UK, Republic of Ireland, France, Spain, Portugal, possibly Azores and Madeira.

Mediterranean Sea: Whole Mediterranean, not in the Black Sea.

Eastern Central and Southeast Atlantic: Morocco, south to South Africa.

Western Indian Ocean: Eastern Cape of South Africa and Kwa-Zulu Natal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Atlantic: British Isles and France to South Africa, including the Mediterranean, Madeira and the Canary Islands. Often referred to as Mustelus canis which is restricted to the western Atlantic.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mediterranean Sea, eastern Atlantic: British Isles and North Sea to South Africa including Madeira; southwestern Indian Ocean: South Africa north to Durban.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 2000 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

200 cm TL (male/unsexed; (Ref. 27000)); max. reported age: 24 years (Ref. 30745)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

A large, plain or black-spotted smoothhound (Ref. 5578). Uniformly grey or greyish-brown above, white below (Ref. 5578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This demersal coastal species is found on the continental shelves and uppermost slopes, from the intertidal to at least 350 m depth, but usually in shallow waters from 5?50 m on sandy and muddy substrates (Bauchot 1987, Zamboni 1999, Serena 2005, Notarbartolo and Bianchi 1998, Compagno et al. 2005). Reproduction is viviparous with yolk-sac placenta. Biological information is available from Tunisia, South Africa, Mauritania and other areas of the Mediterranean Sea. Males mature at 70?112 cm total length (TL) and females at 107.5?124 cm TL (Saïdi et al. 2008, Da Silva 2007) and 80cm TL reported in the Mediterranean Sea (Bauchot 1987, Whitehead et al. 1984, Serena 2005). Saïdi et al. (2008) report that reproduction is annual with parturition taking place during late April and early May and mating during May and early June off Tunisia. The gestation period is 9?11 months (Saïdi et al. 2008, Da Silva 2007, Smale and Compagno 1997, Notarbartolo and Bianchi 1998). Females give birth to 4?18 pups per litter and larger females have significantly larger litters (Fischer et al. 1987, Saïdi et al. 2008, Smale and Compagno 1997). Size at birth is 34?42 cm TL (Saïdi et al. 2008, Bauchot 1987, Serena 2005, Notarbartolo and Bianchi 1998). Da Silva (2007) studied the age and growth of M. mustelus off South Africa. Maximum observed age was 25 years. Age at 50% maturity was determined at 10.75 years for females and 9.1 years for males. Using these data and the formula: age of maturity + 0.5*(length of reproductive period in life cycle), generation period can be estimated at 17.8 years. Natural mortality (M) for M. mustelus was estimated at 0.05 yr-1 (Da Silva 2007). The species preys on fishes (mainly anchovy), crustaceans (Squilla mantis) and mollusks bivalve (Ensis spp.) and cephalopods (Eledone moscata) (Costantini et al. 2000).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; marine; depth range 5 - 624 m (Ref. 56504), usually 5 - 50 m (Ref. 244)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 921 specimens in 1 taxon.
Water temperature and chemistry ranges based on 479 samples.

Environmental ranges
  Depth range (m): -9 - 437
  Temperature range (°C): 6.946 - 19.831
  Nitrate (umol/L): 0.729 - 29.077
  Salinity (PPS): 33.861 - 38.608
  Oxygen (ml/l): 0.979 - 6.408
  Phosphate (umol/l): 0.094 - 2.210
  Silicate (umol/l): 1.925 - 20.533

Graphical representation

Depth range (m): -9 - 437

Temperature range (°C): 6.946 - 19.831

Nitrate (umol/L): 0.729 - 29.077

Salinity (PPS): 33.861 - 38.608

Oxygen (ml/l): 0.979 - 6.408

Phosphate (umol/l): 0.094 - 2.210

Silicate (umol/l): 1.925 - 20.533
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 5 - 350m.
From 5 to 350 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found on the continental shelves and uppermost slopes, from the intertidal region to at least 350 m depth (Ref. 244). Collected to depth of 624 m in the eastern Ionian Sea (Ref. 56504). Sometimes in midwater but prefers to swim near the bottom (Ref. 244). Feeds mainly on crustaceans, but also cephalopods and bony fishes (Ref. 244).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Viviparous, with a yolk-sac placenta; 4 to 17 (Ref. 39938) young in a litter. Size at birth about 39 cm. Distinct pairing with embrace (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 24 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Mustelus mustelus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 19
Specimens with Barcodes: 76
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Mustelus mustelus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCATAAAATTAAATTTTGGTGCATGAGCAGGCATAGTTGGGACAGCTCTAAGCCTTCTAATTCGAGCCGAACTTGGGCAGCCAGGATCACTTTTAGGTGATGATCAGATTTATAATGTGATCGTAACCGCCCATGCTTTTGTAATAATCTTCTTTATGGTTATACCCATCATGATTGGAGGCTTTGGGAATTGACTGGTCCCCTTGATAATTGGTGCTCCAGATATAGCTTTCCCACGTATGAATAACATAAGCTTTTGACTCCTCCCACCATCATTCCTTCTTCTCCTTGCTTCTGCAGGAGTGGAAGCCGGTGCAGGTACCGGCTGAACAGTATATCCACCACTAGCTAGCAATCTAGCCCATGCTGGACCATCTGTTGATTTAGCCATCTTCTCCCTTCATTTAGCCGGTATTTCATCAATCTTAGCCTCAATTAACTTTATTACAACCATTATTAATATAAAACCACCAGCCATTTCCCAATATCAAACGCCATTATTTGTTTGATCAATTCTCGTAACTACTGTTCTTCTTCTTCTCTCCCTGCCAGTTCTTGCAGCAGGGATTACAATATTACTCACAGACCGAAACCTTAATACCACATTCTTTGACCCCGCAGGGGGTGGGGACCCCATCCTTTATCAACACTTATTCTGATTCTTTGGCCACCCAAAATTCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2bd+3bd+4bd

Version
3.1

Year Assessed
2009

Assessor/s
Serena, F., Mancusi, C., Clò, S., Ellis, J. & Valenti, S.V.

Reviewer/s
Fowler, S.L. & Valenti, S.V. (Shark Red List Authority)

Contributor/s

Justification
This coastal species is widespread, from Northern Europe to South Africa, including the Mediterranean Sea, although it is less common in the northern portion of its range. It is usually found in shallow waters at 5?50 m depth, although it occurs to at least 350 m depth. The species is vulnerable to capture in trawl, gillnet, trammel net and line gear. No species-specific fisheries catch data are available for M. mustelus because landings data often refer to all Mustelus species combined. Both catch and fishery-independent scientific survey data available from the Mediterranean Sea and Western Africa suggest that significant declines have occurred in these regions. Exploitation of this species is increasing off South Africa and stock assessment indicates that current catch levels are unsustainable. The species is considered to meet the criteria for Vulnerable globally based on observed and inferred continuing declines over three generations (>50 years) and may prove to meet the criteria for a higher category in the future. Catches and population trends need to be carefully monitored throughout the species? range and management intervention is required.

Northeast Atlantic
Mustelus mustelus is less common than M. asterias, the other co-occurring smoothhound, in the Northeast Atlantic. Data for these two species may be confounded due to misidentification. They are occasionally taken by trawl and gillnet and are often discarded in this region although they may be landed as bait in England and Ireland. They are a relatively important sport fish in some areas, such as the Bristol and English Channels. Species-specific landings data are not available and no other information is currently available to determine the status of this species in the region. As such the species is assessed as Data Deficient in the Northeast Atlantic.

Mediterranean Sea
Mustelus spp are captured with demersal trawls, trammel nets, gillnets and longlines in this region. They are valued for human consumption and are often retained and marketed. Landings of all Mustelus spp (M. mustelus, M. asterias and M. punctulatus, of which M. mustelus is the most common) in the Mediterranean Sea declined by ~85% between 1994 and 2006 (less than one generation). Time series catch data from comparable trawl surveys and landings in the Gulf of Lions, Ligurian Sea, showed a clear decrease in abundance of Mustelus spp from 1970 onwards, although data from the Adriatic Sea suggest that abundance of M. mustelus did not change from 1948?1998.

Eastern Central Atlantic
Species-specific data are available from scientific trawl surveys conducted off Mauritania from 1982?2006, from 5?200 m depth. Estimated biomass for M. mustelus decreased significantly over this period, with biomass declining from ~150,000 t in 1982 and 1988, to ~40,000 t in 2006. The species may have undergone a range contraction on the Mauritanian shelf. Increased fishing pressure has been linked with declines in demersal fish stocks in several areas of this region, including, Mauritania, Senegal and Guinea, most notably, higher-trophic level predators, such as sharks. Declines in M. mustelus are also inferred to have occurred elsewhere in the region, given that fishing pressure is high throughout much of this species? range there.

Southeast Atlantic
Declines in linefish species off South Africa has led to increased exploitation of demersal sharks, such as Mustelus mustelus as both target and bycatch. A comparison of models developed in a stock assessment of the species for South Africa showed that current catches need to be halved for exploitation of Smoothhound Sharks to be sustainable. Survey biomass indices for the southern coast of South Africa showed a clear decline in trend from 1986 to 2003. Survey biomass indices for the western coast increased from 1984 to 1994 and then decreased to levels similar to indices observed prior to 1994.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Northeast Atlantic
Mustelus mustelus is less common than M. asterias in the Northeast Atlantic. Trend data are not available for this species for this region.

Mediterranean Sea
Mustelus mustelus is more common than M. asterias in the Mediterranean Sea. Scientific surveys (MEDITS) of the northern Mediterranean Sea conducted between 1994 and 1999 at 10?800 m depth recorded this species in 111 (2%) of 6,336 hauls (Baino et al. 2001). Aldebert (1997) reports a clear decrease in abundance of Mustelus species in comparable surveys in the Gulf of Lions, southern France, from 1970 onwards. The occurrence of M. mustelus in comparable trawl surveys conducted on the shelf of the Adriatic Sea in 1948 and 1998 remained approximately the same (Jukic-Peladic et al. 2001). In Hvar trawl surveys conducted in 1948 on the shelf of the Adriatic Sea occurrence (frequency log-transformed) of M. mustleus was ~1.0, compared to ~1.0 in comparable MEDITS surveys conducted in the same area in 1998. In Grund surveys conducted in Italian seas between 1985 and 1998, percentage presence of M. mustelus was 21.9%. Most of the population was concentrated in the Adriatic Sea and southern waters of Sicily and the species was absent from the Ligurian Sea and Sardinian waters (Relini et al. 2000).

Eastern Central Atlantic
Trends in abundance are available from data from scientific trawl surveys conducted off Mauritania from 1982?2006, from 5?200 m depth (Gascuel et al. 2007). Biomass estimates were made for 24 different demersal species over the whole continental shelf, including M. mustelus, using standard linear model techniques. Estimated biomass for M. mustelus decreased significantly over this period, with biomass declining from ~150,000 t in 1982 and 1988, to ~40,000 t in 2006 (Gascuel et al. 2007). The mean yearly rate of decrease in biomass was estimated at -0.3%. The decrease in abundance mainly occurred in areas of low densities and marginal habitat for this species, in the deepest strata sampled (80?200 m depth), suggesting that there may have been a contraction in the distribution of this species (Gascuel et al. 2007).

Southeast Atlantic
Relative survey biomass indices from fishery independent research trawl surveys conducted along the western and southern coasts of South Africa are available for Mustelus species from 1986?2003 (Da Silva 2007). Survey biomass indices for the southern coast showed a clear decline in trend from 1986 to 2003 (Da Silva 2007). The survey biomass indices for the western coast increased from 1984 to 1994 and then decreased to levels similar to indices observed prior to 1994 (Da Silva 2007).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Northeast Atlantic
Mustelus spp. are generally regarded as locally common, although they are not very abundant. They are occasionally taken by trawl and gill net, although they have little market value, and are often discarded in this region. They may be landed for human consumption and also as bait for the inshore whelk fishery in England and Ireland. ICES landing statistics combine dogfish and hounds together and so there is little accurate data on North Atlantic landings, and levels of bycatch are unknown. In some areas, such as the Bristol Channel and English Channel in the United Kingdom, they are a relatively important sport fish (Ellis pers. obs.).

Mediterranean Sea
There is a high level of exploitation on the continental shelf and upper slope to about 800m depth in the Mediterranean Sea (Massuti and Moranta 2003). Mustelus spp are captured with demersal trawls, trammel nets, gillnets and longlines in this region (Bauchot 1987, STECF 2003). Semi-industrial fisheries in the Adriatic Sea, off Sicily, Spain and Cyprus are known to take these species, and also artisanal fisheries elsewhere. Mustelus spp are retained and utilised in the Mediterranean Sea, where they regularly sold for human consumption in many areas (Fischer 1987). Landings data reported to FAO show that landings of Mustelus spp (probably including M. mustelus, M. asterias and M. punctulatus, of which M. mustelus is the most common in this region) steadily increased between 1950 and 1978 to 14,000 t, after which they fluctuated between ~6,500 t and 14,000 t from 1978?1994 (FAO 2008). After 1994, landings dropped significantly, decreasing to 2,980 t in 1997 and did not exceed 2,200 t from 2001?2006 (FAO 2008). Although these landings are not species-specific, combined with the results of fishery-independent trawl surveys described above, they also suggest that this species has declined in abundance in the Mediterranean Sea.

Eastern Central Atlantic
This coastal species? range is heavily exploited by demersal fisheries off western Africa. Fishing effort has increased in both efficiency and intensity in this area during the past 50 years. For example, effective fishing effort of the small scale fleet operating off Mauritania is estimated to have increased by a factor of 10 during the past 25 years (Gascuel et al. 2007). The number of and effort exerted by industrial fishing vessels off Mauritania has also increased dramatically, from ~150 vessels to more than 300 and from <40,000 days to >60,000 days, respectively, from 1982?1997 (Gascuel et al. 2007). Fisheries in other countries in the region have also undergone similar development. Increased fishing pressure has been linked with declines in demersal fish stocks in several areas of the region, including, Mauritania, Senegal and Guinea, most notably, higher-trophic level predators, such as sharks (Gascuel et al. 2007). Fishing pressure has not decreased and the declining trend in abundance in M. mustelus observed off Mauritania from 1988?2006 described above, is likely to continue. Declines are also inferred to have occurred elsewhere, given that fishing pressure is high throughout much of this species? range in this region.

Southeast Atlantic
Declines in linefish species off South Africa has led to increased exploitation of demersal sharks, such as Mustelus mustelus as both target and bycatch. Fisheries catch data for M. mustleus in this area is problematic due to misidentification and high levels of underreporting. Da Silva (2007) present information on catches and conducted a stock assessment for M. mustelus off South Africa, using three dynamic pool models (yield per recruit, spawner biomass per recruit and an extended yield and spawner biomass per recruit). The replacement yield model showed that average catches over the past decade are 2.5 times higher than the replacement yield is on the South Coast and 1.30 on the West Coast of South Africa. A comparison of the models showed that current catches need to be halved for exploitation of smoothhound sharks to be sustainable. The species is also taken by recreational anglers off Namibia (NATMIRC 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Vulnerable (VU) (A2bd+3bd+4bd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific management measures in place for M. mustelus throughout the majority of its range. Mustelus species are protected within Balearic Island (Spain) marine reserves.

Few species-specific landings data exist and improved data collection on commercial landings are needed in all areas of its range. Current catch levels appear to be unsustainable throughout the majority of this species? range and management intervention is required to reduce catches. Da Silva reported that size and fishing effort control methods may be most effective for M. mustelus.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; gamefish: yes; price category: medium; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common smooth-hound

The common smooth-hound, Mustelus mustelus, is a houndshark of the family Triakidae, found in the eastern Atlantic Ocean from the British Isles to South Africa, in the Mediterranean Sea, Madeira and the Canary Islands at depths of ranging from 5m to 625m (although they usually stay at depths of 5-50m). While they can grow to 200 cm, their usual maximum size is 150 cm. They commonly grow to 100–120 cm with a birth length around 35 cm. Reproduction is viviparous.

Morphology and behaviour

The common smooth-hound has a grey-brown back and is white on its underneath. It is often confused with the starry smooth-hound which has white spots on its back. The starry smooth-hound can often have faded spots which leads to misidentification. Another shark it is often confused with is the tope shark although the common smooth hound has a larger second dorsal fin. Due to the similarities between the common smooth-hound and other sharks, misidentification occurred for a long time.

The common smooth-hound has two dorsal fins, an anal fin, a pair of pectoral fins, a pair of pelvic fins and a heterocercal tail. All of these fins help stabilise the shark but in males, the pelvic fins are modified to form claspers.

Like other smooth hounds, the common smooth hound will aggregate in large numbers, like a pack of dogs. This is why they are called hounds.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!