Overview

Comprehensive Description

Biology

Adults feed mainly on polychaetes and amphipods (Ref. 27301).
  • Cooper, J.A. and F. Chapleau 1998 Monophyly and intrarelationships of the family Pleuronectidae (Pleuronectiformes), with a revised classification. Fish. Bull. 96(4):686-726. (Ref. 30193)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

North Pacific: Peter the Great Bay to Point Hope in the Chukchi Sea south to Unalaska Island and east to Kayak Island in southeast Alaska.
  • Allen, M.J. and G.B. Smith 1988 Atlas and zoogeography of common fishes in the Bering Sea and northeastern Pacific. NOAA Tech. Rep. NMFS 66, 151 p. (Ref. 6793)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 63 - 74; Analspines: 0; Analsoft rays: 47 - 55
  • Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

87.0 cm TL (male/unsexed; (Ref. 93067)); max. published weight: 3,500 g (Ref. 56527); max. reported age: 37 years (Ref. 93067)
  • Fadeev, N.S. 2005 Guide to biology and fisheries of fishes of the North Pacific Ocean. Vladivostok, TINRO-Center. 366 p. (Ref. 56527)
  • Matta, M. E. 2012 Alaska plaice (Pleuronectes quadrituberculatus). Resource Ecology and Fisheries Management Division, Alaska Fisheries Science Center, NMFS, NOAA, 7600 Sand Point Way NE, Seattle WA 98115. [Available from: http://www.afsc.noaa.gov/REFM/Age/default.htm.] (Ref. 93067)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 600 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

5 high prominences on postocular ridge (Ref. 559).
  • Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; marine; depth range 0 - 600 m (Ref. 50550)
  • Fedorov, V.V., I.A. Chereshnev, M.V. Nazarkin, A.V. Shestakov and V.V. Volobuev 2003 Catalog of marine and freswater fishes of the northern part of the Sea of Okhotsk. Vladivostok: Dalnauka, 2003. 204 p. (Ref. 50550)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 69 specimens in 1 taxon.
Water temperature and chemistry ranges based on 51 samples.

Environmental ranges
  Depth range (m): 0 - 164.5
  Temperature range (°C): -0.660 - 6.711
  Nitrate (umol/L): 0.420 - 30.566
  Salinity (PPS): 31.082 - 33.101
  Oxygen (ml/l): 6.076 - 8.460
  Phosphate (umol/l): 0.645 - 2.462
  Silicate (umol/l): 12.993 - 62.658

Graphical representation

Depth range (m): 0 - 164.5

Temperature range (°C): -0.660 - 6.711

Nitrate (umol/L): 0.420 - 30.566

Salinity (PPS): 31.082 - 33.101

Oxygen (ml/l): 6.076 - 8.460

Phosphate (umol/l): 0.645 - 2.462

Silicate (umol/l): 12.993 - 62.658
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 6 - 475m.
From 6 to 475 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

These benthivores are adapted for extracting polychaetes from the sediment (Ref. 27301).
  • Zhang, C.I. 1988 Food habits and ecological interactions of Alaska plaice, Pleuronectes quadrituberculatus, with other flatfish species in the Eastern Bering Sea. Bull. Kor. Fish. Soc. 21(2):150-160. (Ref. 27301)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pleuronectes quadrituberculatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTCTATCTCGTATTTGGTGCCTGAGCCGGAATAGTGGGGACGGGCCTAAGTCTGCTCATTCGGGCAGAGCTAAGCCAACCTGGGGCTCTCCTGGGAGACGACCAAATTTATAACGTAATCGTCACCGCACACGCCTTTGTAATAATCTTCTTTATAGTAATACCAATTATGATTGGAGGGTTTGGAAACTGACTTATCCCTTTAATAATTGGGGCCCCCGATATGGCCTTCCCCCGAATAAATAACATGAGCTTCTGACTTCTACCCCCATCGTTTCTGCTTCTCCTGGCCTCTTCAGGTGTTGAAGCCGGGGCGGGAACAGGGTGAACCGTATACCCCCCATTAGCTGGAAACCTAGCACACGCTGGGGCATCCGTAGACCTCACAATCTTTTCTCTCCACCTTGCCGGAATTTCATCAATTCTAGGGGCAATCAACTTCATTACTACCATCATCAACATGAAACCTACAGCAGTCACTATGTACCAAATTCCACTATTTGTTTGAGCCGTACTAATTACCGCCGTTCTTCTTCTCCTTTCCCTTCCCGTCTTAGCCGCTGGCATTACAATGCTACTAACAGACCGCAACCTAAACACAACCTTCTTTGACCCTGCTGGAGGGGGTGACCCCATCCTCTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pleuronectes quadrituberculatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
  • Bykov, V.P. 1983 Marine Fishes: Chemical composition and processing properties. New Delhi: Amerind Publishing Co. Pvt. Ltd. 322 p. (Ref. 4883)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Alaska plaice

Alaska plaice (Pleuronectes quadrituberculatus) is a saltwater fish that live in the North Pacific Ocean. Alaska plaice are right-eye flounders which live on the sandy bottoms of the continental shelf, up to 600 metres deep. Their geographic range is from the Gulf of Alaska in the east, to the Chukchi Sea in the north, to the Sea of Japan in the west. Alaska plaice feed mostly on polychaetes, but also eat amphipods and echiurans.

Most commercial fisheries do not target Alaska plaice, and bycatch by commercial trawlers targeting other groundfish is the sole source of significant harvest of this species. Large schools of Alaska plaice are commonly associated with schools of Yellowfin sole, and bycatch rates can reach relatively high levels. The 2005 total allowable catch in the Bering Sea and Aleutian Islands management area (BSAI) was reached before the end of May of that year.

Alaska plaice can live for up to 30 years, and grow to 60 centimetres (24 inches) long, but most that get caught are only seven or eight years old, and about 30 cm (12 in). They are brown on the eyed side and typically pale to bright yellow on the blind side. Five to seven small boney cones are found on the head on the eyed side.

See also[edit]

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!