Overview

Comprehensive Description

Biology

Feeds mainly on polychaetes and amphipods (Ref. 27301).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

North Pacific: Peter the Great Bay to Point Hope in the Chukchi Sea south to Unalaska Island and east to Kayak Island in southeast Alaska.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 63 - 74; Analspines: 0; Analsoft rays: 47 - 55
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 600 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

62.0 cm TL (male/unsexed; (Ref. 56527)); max. published weight: 3,500 g (Ref. 56527)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

5 high prominences on postocular ridge (Ref. 559).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; marine; depth range 0 - 600 m (Ref. 50550)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 69 specimens in 1 taxon.
Water temperature and chemistry ranges based on 51 samples.

Environmental ranges
  Depth range (m): 0 - 164.5
  Temperature range (°C): -0.660 - 6.711
  Nitrate (umol/L): 0.420 - 30.566
  Salinity (PPS): 31.082 - 33.101
  Oxygen (ml/l): 6.076 - 8.460
  Phosphate (umol/l): 0.645 - 2.462
  Silicate (umol/l): 12.993 - 62.658

Graphical representation

Depth range (m): 0 - 164.5

Temperature range (°C): -0.660 - 6.711

Nitrate (umol/L): 0.420 - 30.566

Salinity (PPS): 31.082 - 33.101

Oxygen (ml/l): 6.076 - 8.460

Phosphate (umol/l): 0.645 - 2.462

Silicate (umol/l): 12.993 - 62.658
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 6 - 475m.
From 6 to 475 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

These benthivores are adapted for extracting polychaetes from the sediment (Ref. 27301).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pleuronectes quadrituberculatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTCTATCTCGTATTTGGTGCCTGAGCCGGAATAGTGGGGACGGGCCTAAGTCTGCTCATTCGGGCAGAGCTAAGCCAACCTGGGGCTCTCCTGGGAGACGACCAAATTTATAACGTAATCGTCACCGCACACGCCTTTGTAATAATCTTCTTTATAGTAATACCAATTATGATTGGAGGGTTTGGAAACTGACTTATCCCTTTAATAATTGGGGCCCCCGATATGGCCTTCCCCCGAATAAATAACATGAGCTTCTGACTTCTACCCCCATCGTTTCTGCTTCTCCTGGCCTCTTCAGGTGTTGAAGCCGGGGCGGGAACAGGGTGAACCGTATACCCCCCATTAGCTGGAAACCTAGCACACGCTGGGGCATCCGTAGACCTCACAATCTTTTCTCTCCACCTTGCCGGAATTTCATCAATTCTAGGGGCAATCAACTTCATTACTACCATCATCAACATGAAACCTACAGCAGTCACTATGTACCAAATTCCACTATTTGTTTGAGCCGTACTAATTACCGCCGTTCTTCTTCTCCTTTCCCTTCCCGTCTTAGCCGCTGGCATTACAATGCTACTAACAGACCGCAACCTAAACACAACCTTCTTTGACCCTGCTGGAGGGGGTGACCCCATCCTCTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pleuronectes quadrituberculatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Alaska plaice

Alaska plaice (Pleuronectes quadrituberculatus) is a saltwater fish that live in the North Pacific Ocean. Alaska plaice are right-eye flounders which live on the sandy bottoms of the continental shelf, up to 600 metres deep. Their geographic range is from the Gulf of Alaska in the east, to the Chukchi Sea in the north, to the Sea of Japan in the west. Alaska plaice feed mostly on polychaetes, but also eat amphipods and echiurans.

Most commercial fisheries do not target Alaska plaice, and bycatch by commercial trawlers targeting other groundfish is the sole source of significant harvest of this species. Large schools of Alaska plaice are commonly associated with schools of Yellowfin sole, and bycatch rates can reach relatively high levels. The 2005 total allowable catch in the Bering Sea and Aleutian Islands management area (BSAI) was reached before the end of May of that year.

Alaska plaice can live for up to 30 years, and grow to 60 centimetres (24 inches) long, but most that get caught are only seven or eight years old, and about 30 cm (12 in). They are brown on the eyed side and typically pale to bright yellow on the blind side. Five to seven small boney cones are found on the head on the eyed side.

See also[edit]

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!