Overview

Comprehensive Description

Biology

Inhabits backwaters and quiet vegetated pools of creeks and small to medium rivers, over mud and sand. Usually found schooling in fairly deep water (of 1-2 m depth) (Ref. 5723).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (20,000-200,000 square km (about 8000-80,000 square miles)) Range includes Gulf Coast drainages, mostly below the Fall Line, from Pearl River, Louisiana and Mississippi, to Apalachicola River, Florida and Georgia; and St. Johns River drainage, Florida (Page and Burr 2011). This species is apparently absent from the Escatawpa River system and from the Perdido River in Alabama (Boschung and Mayden 2004). Spotty distribution in the Chipola, Choctawhatchee, Yellow, Escambia, Alabama, Cahaba, and Tombigbee river systems (Boschung and Mayden 2004, Smith et al. 2008). Overall, the species occurs primarily in small, localized populations, and its distribution appears to be severely fragmented (as defined by IUCN).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southeastern U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: St. Johns River drainage, Florida; in the Gulf Coast drainages (mostly below Fall Line) from Apalachicola River, Georgia and Florida to Pearl River, Mississippi and Louisiana, USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Bluenose shiners, Pteronotropis welaka were first discovered in the St. Johns River near the town of Welaka, Florida. Their range currently extends from the St. Johns River system in eastern Florida to the Pearl River drainage basin in Louisiana, encompassing parts of Mississippi and Alabama. This distribution, however, is very fragmented. Isolated populations also occur in the lower Flint River system in Georgia.

Biogeographic Regions: nearctic (Native )

  • Albanese, B., J. Peterson, B. Freeman, D. Weiler. 2007. Accounting for Incomplete Detection when Estimating Site Occupancy of Bluenose Shiner (Pteronotropis welaka) in Southwest Georgia. Southeastern Naturalist, 6(4): 657-668.
  • Evermann, B., W. Kendall. 1898. Descriptions of new or little-known genera and species of fishes from the United States. Bulletin of the U.S. Fish Commision, 17: 125-133.
  • Ross, S., W. Brenneman, W. Slack, M. O'Connell, T. Peterson. 2001. Inland Fishes of Mississippi. Singapore: University Press of Mississippi.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Bluenose shiners are smaller than other cyprinids, and the longest recorded individual was 53 mm in length. They are slender, compressed, and cylindrical in shape. They have a pointed snout and an oblique terminal to subterminal mouth. Their snout becomes slightly swollen during the breeding season. Bluenose shiners have a lateral line which runs the entire length of the fish and covers only about 6 anterior scales. They have 11 to 13 scales above the lateral line and 9 to 11 below. Scales are large and completely cover their ventral side. Bluenose shiners have 8 dorsal-fin rays, 8 to 9 anal-fin rays, 14 to 15 pectoral-fin rays, and 8 pelvic-fin rays. They do not have spines. Their dorsal fin is located posterior to the pelvic fin and is equally spaced between the snout and caudal fin. They have a homocercal caudal fin, meaning the upper and bottom lobes are the same length.

Male and female bluenose shiners vary in physical characteristics and coloration. When breeding, males develop tubercles on their upper and lower jaws, head, and pectoral fin rays. Males also change in color while mating: their snout and head turn royal blue, and gold flecks develop on the side of the body. The male’s larger dorsal fin turns black, while the anal, pelvic, and pectoral fins turn yellow and white. In older males, dorsal, anal, and pelvic fins increase in length. Females have a more prominent black lateral band. Females occasionally develop a blue snout when mature, although they usually lack most of the vibrant coloration of males.

Range length: 53 (high) mm.

Other Physical Features: ectothermic ; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently; male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 5 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 65 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

6.0 cm TL (male/unsexed; (Ref. 12468))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Holotype for Notropis welaka
Catalog Number: USNM 48786
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): W. Kendall
Year Collected: 1897
Locality: St. Johns R., Welaka, Florida, Florida, United States, North America
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Notropis welaka
Catalog Number: USNM 48785
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): W. Kendall
Year Collected: 1897
Locality: St. Johns R., Welaka, Florida, Florida, United States, North America
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Notropis welaka
Catalog Number: USNM 127014
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): W. Kendall
Year Collected: 1897
Locality: Florida.: Welaka, St. Johns R., Florida, United States, North America
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Habitat includes deep, slow-moving, coastal creeks and small to medium rivers of varying clarity and usually with silty bottoms, often heavily choked with brush and vegetation (Lee et al. 1980, Page and Burr 2011). These shiners seem to prefer deep pools and backwaters (often 1-2 meters) to more shallow areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Habitat includes deep, slow-moving, coastal creeks and small to medium rivers of varying clarity and usually with silty bottoms, often heavily choked with brush and vegetation (Lee et al. 1980, Page and Burr 2011). These shiners seem to prefer deep pools and backwaters (often 1–2 m) to more shallow areas.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; freshwater; pH range: 6.5; dH range: 10
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bluenose shiners are most commonly found in small, clear headwater streams with high turbidity. They prefer deep muddy-bottom areas of vegetated streams that include the broad leave plant genera Sagittaria, Potamogeton, and g. Utricularia. Because of their dependence on deep pools and aquatic vegetation, viable habitat is becoming increasingly limited due to human development and stream alteration.

Habitat Regions: freshwater

Aquatic Biomes: rivers and streams

  • Cook, F. 1959. Freshwater Fishes in Mississippi. Jackson, Mississippi: Mississippi Game and Fish Commision.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Bluenose shiners are primarily herbivorous, mostly consuming filamentous algae. However, they also eat eggs and fry during the spawning season. They often nest with sunfish and, when the sunfish guarding the nest leaves, male bluenose shiners often prey on sunfish eggs. Bluenose shiners may also eat their own eggs, though the larger sunfish eggs are preferred.

Animal Foods: eggs

Plant Foods: algae

Primary Diet: herbivore (Algivore); omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Bluenose shiners consume algae and act as prey to other fish. They also are a nest associate with sunfish, and male bluenose shiners help protect the nest, cashing off other fish that may pose a treat. Males bluenose shiners, however, are also known to eat sunfish eggs if the adult sunfish leave the nest.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Bluenose shiners live in small headwater streams and occasionally in isolated pools in close proximity to predators. Some other cyprinids, such as creek chub, are piscivorous and eat other cyprinids, such as bluenose shiners. Bluenose shiners often swim in schools, perhaps to reduce predation.

Known Predators:

  • Fraser, D., R. Cerri. 1982. Experimental Evaluation of Predator-Prey Relationships in a Patchy Environment: Consequences For Habitat Use Patterns In Minnows. Ecology, 63(2): 307-313.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 80

Comments: This species is represented by a fairly large number of occurrences (subpopulations) and locations (as defined by IUCN). Boschung and Mayden (2004) mapped 25 collection sites in Alabama. Smith et al. (2008) listed 25 historical collection sites in Alabama, and in 2007 they collected bluenose shiners in 7 of these sites. Ross (2001) mapped approximately 30 collection sites in Mississippi. Gilbert (in Lee et al. 1980) mapped at least 18 collection sites in Florida.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

Unknown

Comments: Total adult population size is unknown. This species is relatively difficult to collect, so it may be more common than available information indicates.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Usually in schools.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Little is known regarding communication or perception of bluenose shiners. They travel in schools and have large eyes, which may be indicative of communication of some form and visual perception respectively.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

In the protolarval stage, which occurs around 4.4 to 5.7 mm of length, bluenose shiners develop a mouth and large round eyes, and the gut area begins to darken. They develop into mesolarve at 7 mm in length. During this stage, eyes enlarge and pigmentation increases throughout the body, especially in the lips. As metalarvae, at 12 to 18 mm of length, bluenose shiners develop a two-chambered air bladder. Pectoral and pelvic fins continue to develop, and their anal rays are fully formed. Pigmentation is visible in a caudal spot, lips, gut, a midlateral band on the caudal peduncle, a lateral band, and a band on the opercle. In juvenlie fish, the lateral band, caudal spot, and a pale band on each side of the dark lateral band are easily visible. As body size of males increases, so does fin length, pigmentation, and relative weight of testes.

  • Johnston, C., C. Knight. 1999. Life-History Traits of the Bluenose Shiner, Pteronotropis welaka (Cypriniformes: Cyprinidae). Copeia, 1: 200-205.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Most bluenose shiners only survive a couple of years. Most die during the summer of their second year directly after their first spawning season.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Little information is available regarding the mating system of bluenose shiners.

Spawning of bluenose shiners peaks between May and July, and females usually spawn more than once in a season. Bluenose shiners are a nest associate of various North American sunfish, and juveniles spend their early developmental stages with the juvenile sunfish they nest with. Bluenose shiners also nest in vegetation. Males are aggressive during spawning season and chase away other bluenose shiners from the nest. Several males usually remain near a single nest.

Breeding interval: Bluenose shiners may spawn multiple times in one season.

Breeding season: Spawning of bluenose shiners peaks between May and July.

Key Reproductive Features: semelparous ; sexual ; fertilization (External ); oviparous

Little information is available regarding parental investment of bluenose shiners. Males, however, aggressively chase away other bluenose shiners from the nest. Several males usually remain near a single nest.

Parental Investment: pre-hatching/birth (Protecting: Male)

  • Goldstein, R. 2001. Corrections and Updates to American Aquarium Fishes. American Currents, Winter: 22-26.
  • Johnston, C. 1999. The Relationship of Spawning Mode to Conservation of North American Minnows (Cyprinidae). Environmental Biology of Fishes, 55: 21-30.
  • Johnston, C., C. Knight. 1999. Life-History Traits of the Bluenose Shiner, Pteronotropis welaka (Cypriniformes: Cyprinidae). Copeia, 1: 200-205.
  • Simons, A., E. Knott, R. Mayden. 2000. Assessment of Monophyly of the Minnow Genus Pteronotropis (Teleostei: Cyprinidae). Copeia, 4: 1068-1075.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pteronotropis welaka

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTAGTATTTGGTGCCTGAGCCGGAATAGTCGGCACCGCTTTAAGCCTCCTCATTCGGGCGGAACTAAGTCAACCTGGCTCACTGCTAGGAAATGATCAAATTTATAATGTTATCGTTACTGCTCACGCCTTTGTAATAATCTTCTTCATAGTCATACCAATCCTTATTGGTGGATTCGGAAACTGACTTGTACCTCTAATAATTGGTGCACCAGACATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTTTTACCCCCATCTTTTCTACTACTTCTGGCCTCTTCTGGGGTTGAAGCCGGGGCTGGAACAGGATGAACTGTGTACCCCCCACTTGCAGGCAACCTCGCTCATACGGGGGCATCCGTGGACCTCACAATCTTTTCTCTTCATCTAGCAGGTGTGTCATCAATTCTAGGCGCAGTTAATTTCATTACTACAATTATTAACATAAAACCTCCAGCAATTTCTCAATATCAAACGCCCCTCTTCGTGTGGGCCGTACTTGTAACTGCTGTCCTTCTACTCCTGTCACTGCCTGTCCTAGCTGCTGGAATTACTATGCTCCTTACCGACCGTAATCTAAATACTTCATTCTTTGACCCAGCAGGAGGAGGTGACCCTATTCTGTATCAACATTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pteronotropis welaka

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Fragmented distribution in the southeastern United States; declining as a result of habitat alteration (removal of vegetation, stream sedimentation).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
B2ab(ii,iii,iv,v)

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
This species is listed as Vulnerable because its area of occupancy is unknown but may be less than 2,000 sq km, number of locations exceeds 10 but distribution appears to be severely fragmented, and habitat quantity and quality, and species' distribution and abundance, are subject to ongoing declines.

History
  • 1996
    Data Deficient
  • 1994
    Rare
    (Groombridge 1994)
  • 1990
    Rare
    (IUCN 1990)
  • 1988
    Rare
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Rare
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The states of Florida, Alabama, and Mississippi list bluenose shiner as a species of special concern, and in Georgia they are considered threatened. They are at risk primarily because they are short lived, populations are isolated, and because of human factors. Human clearing of vegetation along stream banks as well as sediment runoff from agriculture practices and urban development are particularly harmful to bluenose shiners. Populations are often small and isolated, and a population can easily be destroyed by harvesting for the aquarium trade. Conservation efforts must also take into consideration the importance of other fish and plant species to the survival of bluenose shiners.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: data deficient

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: Trend over the past 10 years or three generations is uncertain, but distribution and abundance probably are slowly declining. Boschung and Mayden (2004) noted the "ever decreasing" habitat in Alabama.

This species may be abundant at a location only to disappear for years at a time (Hipes et al. 2001).

Global Long Term Trend: Decline of 10-50%

Comments: Populations have been lost, but the overall degree of decline is uncertain. Ross (2001) noted that several local populations in Mississippi had disappeared within the last decade.

Preliminary data suggest that this species is much rarer in the western panhandle of Florida than originally presumed. Species has apparently declined in the upper St. Johns River (based on multiple collections at known sites) (Hipes et al. 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a fairly large number of occurrences (subpopulations) and locations (as defined by IUCN). Boschung and Mayden (2004) mapped 25 collection sites in Alabama. Smith et al. (2008) listed 25 historical collection sites in Alabama, and in 2007 they collected Bluenose Shiners in seven of these sites. Ross (2001) mapped approximately 30 collection sites in Mississippi. Gilbert (in Lee et al. 1980) mapped at least 18 collection sites in Florida.

Total adult population size is unknown. This species is relatively difficult to collect, so it may be more common than available information indicates.

Populations have been lost, but the overall degree of decline is uncertain. Ross (2001) noted that several local populations in Mississippi had disappeared within the last decade.

Preliminary data suggest that this species is much rarer in the western panhandle of Florida than originally presumed. It has apparently declined in the upper St. Johns River (based on multiple collections at known sites) (Hipes et al. 2001).

Trend over the past 10 years or three generations is uncertain, but distribution and abundance probably are slowly declining. Boschung and Mayden (2004) noted the "ever decreasing" habitat in Alabama.

This species may be abundant at a location only to disappear for years at a time (Hipes et al. 2001).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Somewhat fragmented distribution make local populations vulnerable to catastrophic events (Boschung and Mayden 2004). Removal of aquatic vegetation in small headwater streams where small, isolated populations occur can have devastating effects on these populations (Boschung and Mayden 2004).

Ross (2001) noted that population losses have occurred where streamside vegetation has been removed, or where agricultural or urban development results in stream sedimentation. The shiners' reliance on deep pools of small headwater streams makes them particularly sensitive to such localized impacts (Ross 2001). Population are susceptible to depletion by excessive collection by aquarists (Ross 2001).

This species was regarded as vulnerable by Warren et al. (2000) and Jelks et al. (2008), based on present or threatened destruction, modification, or reduction of habitat or range,

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
The somewhat fragmented distribution makes local populations vulnerable to catastrophic events (Boschung and Mayden 2004). Removal of aquatic vegetation in small headwater streams where small, isolated populations occur can have devastating effects on these populations (Boschung and Mayden 2004).

Ross (2001) noted that population losses have occurred where streamside vegetation has been removed, or where agricultural or urban development results in stream sedimentation. The shiners' reliance on deep pools of small headwater streams makes them particularly sensitive to such localized impacts (Ross 2001). Population are susceptible to depletion by excessive collection by aquarists (Ross 2001).

This species was regarded as vulnerable by Warren et al. (2000) and Jelks et al. (2008), based on present or threatened destruction, modification, or reduction of habitat or range,
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The main conservation need is habitat protection.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of bluenose shiners on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Male bluenose shiners are very colorful and have elongated fins, making them popular aquarium fish. Several cyprinid species are raised for bait, and the baitfish industry has grown considerably and is now worth millions of dollars.

Positive Impacts: pet trade

  • Phillip, C., M. Hoy. 1997. Lesser Scaup Depredation and Economic Impact at Baitfish Facilities in Arkansas. Thirteenth Great Plains Wildlife Damage Control Workshop Proceedings, 6: 156-161.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bluenose Shiner

The Bluenose Shiner (Pteronotropis welaka) is a species of ray-finned fish in the Cyprinidae family. It is found only in the United States. This is mostly found in florida and parts of Alabama.

Source[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly included in the genus Notropis. Subgenus Pteronotropis was elevated to genus rank by Mayden (1989). This change was adopted by Page and Burr (1991) and Mettee et al. (1996). Pteronotropis was retained as a subgenus of Notropis by Coburn and Cavender and in the 1991 AFS checklist (Robins et al. 1991). A phylogenetic analysis using mtDNA data failed to resolve Pteronotropis as a monophyletic group but was unable to reject the hypothesis of monophyly using both the Templeton and Kishino-Hasegawa tests (Simons et al. 2000). Resolution of relationships of Notropis, Pteronotropis, and other cyprinids will require further analysis using substantially more taxa and sequence data (Simons et al. 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!