Articles on this page are available in 1 other language: Arabic (18) (learn more)

Overview

Brief Summary

Description

A prehistoric-looking fish, the Yangtze sturgeon has a long and slender body covered with rough skin and bony plates. A pointed snout extends from the triangular head and two pairs of barbels hang from the lower jaw. The upper side of the body varies from dark yellow through brown to dark grey, and this fades to milky white on the underside (4). Juveniles have a black body and tail with a light grey line running from head to tail (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

This nocturnal fish undertakes regular migrations, and after becoming sexually mature at seven to eight years old, it swims upstream during the spring floods each year to spawn. A large number of sticky eggs are produced, which adhere securely to stones on the riverbed (4). From hatching to around three weeks old, the tiny juveniles remain close to the river bottom, feeding on zooplankton and hiding from predators. Once they reach 10 to 11 weeks old, they are large enough to migrate downstream to join the adults (5). Older Yangtze sturgeon consume small fish and aquatic plants (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Distribution

Endemic Range/ Yangtze River Basin

Acipenser dabryanus is an endangered demersal fish found in portions of the Yangtze River Basin, previously inhabitating even greater extents of the basin. The upper Yangtze basin is considered the part from the headwaters to the Three Gorges area, or a catchment area of approximately one million square kilometers; this upper basin is quite mountainous. The upper Yangtze basin consists chiefly of Paleozoic limestone and terrigenous sedimentary rock, with some granitic material. The highest elevation ecoregion of the Yangtze Basin is the uppermost reach or headwaters catchment area of the Yangtze, known as the Tibetan Plateau alpine shrub and meadows.

The most downstream element of the upper Yangtze basin is often termed the Sichuan Basin; here the Yangtze cuts through Triassic and Permian material before entering the Three Gorges. The Three Gorges area is a stretch of the Yangtze that runs approximately 660 kilometers, terminating at the site of the Three Gorges Dam. Construction of this dam without adequate biotic mitigation has resulted in considerable aquatic habitat degradation and decline of native fish populations.

The demersal fish Silurus meridionalis also is found as a middle reach Yangtze River endemic species. Some of the notably large native demersal fish occurring in the Yangtze Basin are the 120 centimeter (cm) long Chinese sturgeon (Acipenser sinensis), the 200 cm Giant mottled eel (Anguilla marmorata), the 122 cm black carp (Mylopharyngodon piceus) and the 300 cm Chinese paddlefish (Psephurus gladius), and the 100 cm Silurus meridionalis.

  • C.Michael Hogan. 2012. Yangtze River. Encyclopedia of Earth. Topic ed. Peter Saundry. Ed.-in-chief Cutler J.Cleveland. National Council for Science and the Environment. Washington DC http://www.eoearth.org/article/Yangtze_River?topic=78166
  • Fishbase. 2010. Fish species in the Yangtze River Basin
Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Asia: China in Yangtze River system (Ref. 4537) and Korea (Ref. 12218). Endangered, close to extinction (Ref. 6866). International trade restricted (CITES II, since 1.4.98).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is endemic to China and is restricted to the Yangtze River system. Historically, under the natural, unaltered conditions that existed until the middle of the 20th century, this species inhabited the upper and middle reaches of the Yangtze River and its large tributaries, including the Ming, Tuo, Jialing, Xiang and Han rivers, as well as the large lakes linking attached to the Yangtze River.

A. dabryanus has recently (possibly since 1995) been extirpated from the lower river and is restricted to the upper main stream of the Yangtze River in the Sichuan Province. It also enters major tributaries, including the Ming, Tuo, and Jialing rivers. (Zhuang et al. 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Yangtze River basin, China and Korea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Endemic to the Yangtze River, China (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 40 - 49; Analspines: 0; Analsoft rays: 27 - 30
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Max. size

250 cm TL (male/unsexed; (Ref. 38401))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Snout short and pointed; lips with small papilla; barbels 2 pairs and situated in belly of snout; body covered with 5 rows of ganoid scales and skin between scales rough (Ref. 45563).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Yangtze River Demersal Habitat

This taxon is one of a number of demersal species in the Yangtze River system. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton.

The upper Yangtze basin consists chiefly of Paleozoic limestone and terrigenous sedimentary rock, with some granitic material. The most downstream element of the upper Yangtze basin is often termed the Sichuan Basin; here the Yangtze cuts through Triassic and Permian material before entering the Three Gorges. The Three Gorges area is a stretch of the Yangtze that runs approximately 660 kilometers, terminating at the site of the Three Gorges Dam. Prior to construction of the dam, the Three Gorges area was a site of exceptional natural beauty; after dam construction the gorge areas were filled with approximately 100 meters in depth of Yangtze water, and considerable amounts of the watershed were graded.

The lower Yangtze basin consists of anabranching river structures and Pleistocene coastal terraces. Prior to development of the Three Gorges Dam, the Yangtze Delta was replenished with a copious sediment load reaching the river mouth; however, the dam has now severely limited the natural flow and deposition of sediment to the delta region. Consequently, the integrity of the delta is been compromised, with scouring exceeding deposition, and the very stability of the delta is endangered.

Lower and middle basins of the Yangtze carry heavy pollutant loads. In the lower Yangtze basin nitrate levels are high, measuring at about 1000 tons per day at Datong; these levels accrue from high applications of chemical fertilizer applied and also considerable loadings of untreated sewage due to the large human population of the basin, with correspondingly little infrastructure for sewage treatment.

Heavy metal concentrations are also high in the lower Yangtze, with measurements of dissolved lead at 0.078 microgram/liter; cadmium (0.024 microgram/liter), chromium (0.57 microgram/liter), copper (1.9 microgram/liter), and nickel (0.50 microgram/liter). Levels of dissolved arsenic have been measured at 3.3 microgram/liter) and zinc at 1.5 microgram/liter), both notably higher by factors of 5.5 and 2.5 respectively than other typical large world rivers. In Yangtze River suspended sediment, arsenic comprises 31 microgram/gram, lead comprises 83 microgram/gram, and nickel comprises 52 micrograms/gram of sediment content

There are several large native demersal fish found in the Yangtze River, chiefly the 250 centimeter (cm) long endangered Yangtze sturgeon (Acipenser dabryanus), the 120 cm Chinese sturgeon (Acipenser sinensis), the 200 cm Giant mottled eel (Anguilla marmorata), the 122 cm black carp (Mylopharyngodon piceus), the 300 cm Chinese paddlefish (Psephurus gladius), and the 100 cm Silurus meridionalis. Furthermore, there are a few exceptionally large native benthopelagic fishes found in the Yangtze, namely, the 105 cm Silver carp (Hypophthalmichthys molitrix), the 200 cm Wuchang bream (Megalobrama amblycephala), the 200 cm yellowcheek (Elopichthys bambusa), the 145 cm common carp (Cyprinus carpio carpio), the 122 cm Mongolian redfin (Chanodichthys mongolicus), the 102 cm predatory carp (Chanodichthys erythropterus) and the 100 cm snakehead (Channa argus argus).. The demersal fish Silurus meridionalis also is found as a Yangtze River endemic species.

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Environment

demersal; anadromous (Ref. 51243); freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This is a small sturgeon species that is permanently resident in freshwater. It usually inhabits the middle and lower layers of the water and prefers slow moving water that is rich in humus, and feeds on demersal organisms (those that live at or near the bottom of a body of water).

This species spawns in upper reaches of the Yangtze River, in the spring (March-April) and the autumn (October-December). Its key spawning reach is between Maoshui and Heijang, a stretch of 321.7 km (The Chanjiang Aquatic Resources Survey Group 1988).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Yangtze sturgeon is found in a variety of freshwater habitats, away from the riverbank in water eight to ten metres deep. Adults appear to prefer regions with a sandy silt bottom, and young stay in sandy shallows (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits the middle and lower reaches of rivers.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acipenser dabryanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCGTTGATTCTTTTCTACTAACCACAAAGATATTGGCACCCTGTATTTAGTATTTGGTGCCTGAGCAGGCATAGTCGGCACAGCCCTCAGCCTTCTGATCCGTGCCGAACTGAGCCAACCCGGTGCCTTGCTTGGCGAT---GACCAGATCTACAATGTTATCGTTACAGCCCACGCCTTTGTCATGATTTTCTTTATAGTAATACCCATCATAATTGGCGGATTCGGAAACTGACTGGTCCCCCTAATAATTGGAGCCCCAGACATGGCATTCCCTCGTATGAACAATATGAGCTTCTGGCTCCTACCCCCATCCTTCCTACTCCTTCTGGCCTCCTCTGGGGTAGAGGCCGGGGCCGGCACAGGATGAACTGTTTACCCCCCACTGGCGGGAAACCTGGCCCATGCAGGAGCCTCTGTAGACCTAACCATTTTCTCCCTCCACCTGGCCGGGGTATCGTCCATTTTAGGAGCTATTAATTTTATCACCACAATTATTAACATGAAACCCCCCGCAGTATCCCAATACCAGACACCTCTATTTGTATGATCTGTATTAATCACGGCCGTGCTTCTCCTGCTGTCACTGCCAGTGCTAGCTGCGGGGATCACAATACTTCTAACAGATCGAAATTTAAACACCACCTTCTTTGACCCAGCCGGAGGAGGAGACCCCATCCTCTACCAACACCTATTTTGATTCTTTGGCCACCCAGAGGTGTACATTCTAATTCTACCAGGATTCGGCATGATCTCCCACATTGTAGCCTACTATGCCGGCAAAAAAGAACCTTTTGGCTATATAGGAATAGTGTGGGCCATAATGGCTATTGGACTACTAGGCTTTATCGTGTGAGCTCATCACATATTTACAGTTGGAATGGACGTAGACACACGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Acipenser dabryanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2bcd

Version
3.1

Year Assessed
2010

Assessor/s
Qiwei, W.

Reviewer/s
Pourkazemi, M., Zhang, H., Du, H. & Smith, K.

Contributor/s

Justification
This species is endemic to China and is restricted to the Yangtze River system. It has recently been extirpated from the lower reaches of river and is now restricted to the upper main stream in the Sichuan Province. It also enters major tributaries, including the Ming, Tuo, and Jialing rivers. In the late 20th century population numbers declined drastically due to overfishing and habitat degradation. Incidental catch data between 1982 and 2008 indicate that since 1982 only tens of specimens are being captured annually. Artificial propagation began in 1976 by the Chongqing Fisheries Institute, China. Since 2007, more than 5,000 individuals have been released into the upper reaches of the Yangtze River for stock rehabilitation (Zhang et al. 2009). Dam construction has caused major adverse effects to the habitat of this species and have resulted in a reduction in its area of occurrence of this species. The naturally occurring population is considered to be very small and it is thought this species only survives in the wild due to restocking. No evidence exists to show that re-stocked animals are reproducing in the wild. Therefore, due to inferred and suspected population declines, along with a decrease in the area of occupancy and historical overfishing, this species has been assessed as Critically Endangered (Possibly Extinct).

History
  • 1996
    Critically Endangered
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

The Yangtze sturgeon is classified as Critically Endangered (CR) on the IUCN Red List 2007 (1), and is listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The natural population of this species was not considered to be large. Historically, this was an important species in commercial fisheries of the upper reaches of the Yangtze River (Chen 2007). In the late 20th century population numbers declined drastically because of overfishing and habitat degradation. Incidental catch data between 1982 and 2008 indicate that since 1982 only tens of specimens are being captured annually and there have been no capture records below the Gezhouba Dam since 1995. The stock has dropped markedly during the past 20 to 30 years and now the production is so small and scattered, that no exact account of total production is reported. Artificial propagation began in 1976 by the Changjianq Fisheries Institute, China. Since 2007, more than 5,000 individuals have been released into the upper reaches of the Yangtze River for stock rehabilitation (Zhang et al. 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Critically Endangered (CR) (A2bcd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
This species has historically experienced unsustainable levels of fishing. Furthermore, mesh sizes of fishing nets have reduced, thereby capturing young, especially during the periods when many juveniles concentrate to feed.

Fishing effort and intensity has also increased in the past, for example in the Neijiang reach of the Tuo River there were only 500 fishing boats in 1950s, but this number increased to about 2000 by 1985. In the Leshan Reach of the Ming River, drift gill nets are crowded together from day to night.

The primary traditional fishing season in the main stream of Yangzte River is between March and August, with more than 30% of the catch processed between April and May. However, this is also spawning season of A. dabryanus, therefore spawning stock are particularly vulnerable to capture.

Furthermore, the construction of the Gezhouba Dam in 1981 and the Three Gorges Dam in 2003 have caused major adverse effects to the habitat of this species and have resulted in a reduction in the area of occurrence of this species, which is now restricted to the upstream river, above the dams. More recently, the construction of the Xiangjiaba Dam in 2008 is situated in the middle of this species spawning reach and therefore is expected to adversely affect the population through habitat fragmentation and associated habitat degradation.

Additionally pollution from increasing human development affects the entire Yangtze basin. Much untreated waste water discharges into the river each year. Water quality is also affected by run-off caused by deforestation of the the upper Yangtze Valley (Zhuang et al. 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Yangtze sturgeon is at risk from over-fishing, pollution, and habitat degradation and loss. An important factor in its decline was the construction of the Gezhouba Dam across the Yangtze River at Yichang in Hubei Province in 1981. As this prevented upstream migration necessary for spawning, the Yangtze sturgeon is now only found above the dam (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
A three month seasonal fishing ban between February and April was introduced in 2002 in the upper Yangtze River.

This species has been listed as a First Class Protected Animal of the State since 1988, and has received the same effective protection as Acipenser sinensis. This species was also listed on CITES Appendix II in 1998.

Artificial propagation was first carried out in 1976. Since 2007 more than 5000 juveniles have been released into the upper Yangtze River for stock rehabilitation, but these species are not thought to be breeding in the wild and no larvae have been seen in recent years.

It is considered that the survival of this species is entirely reliant on restocking efforts, without which this species would possibly become extinct (Zhang et al. 2009).

Since the 1970s, the Institute of Aquatic Products of Sichuan Province have increased efforts regarding raising and breeding of A. dabryanus. For example young A. dabryanus from the Yangtze River have been introduced into the Changshou City reservoir for culturing (The Changjiang Aquatic Resources Survey Group 1988).

In 2000 the first national nature reserve was created in the upper Yangzte river. The area of this reserve was extended in 2005 to mitigate the conflict between hydroelectric projects and the maintenance of the functionality of the ecosystem. The reserve is now the largest aquatic reserve in China, which has a total length of 1162.6 km (including 436.5 km of the main river) (Zhang et al. 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation of this fish is now urgent, with emphasis needed on habitat protection, capture control and stock replenishment. This sturgeon species spawns earlier in life than most sturgeons, and therefore has aquaculture potential for caviar production. Controlled production of the Yangtze sturgeon could both reduce fishing levels and allow reintroductions of fish back into the river (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Dabry's sturgeon

The Yangtze Sturgeon (Acipenser dabryanus), also known as Dabry's Sturgeon, is a member of the family Acipenseridae and the order Acipenseriformes. As suggested by its name, it is restricted to the Yangtze River Basin in China, but it has declined drastically and is now considered critically endangered.[1] Its continued survival is entirely reliant on restocking and several thousand specimens have been released since 2007, but these are not believed to have begun breeding in the wild.[1] It shares its range with another threatened sturgeon, the Chinese sturgeon.

It is an animal strictly protected by the Chinese government, named a "national treasure" much like its mammalian counterpart, the Giant Panda.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!