Overview

Comprehensive Description

Biology

A solitary species (Ref. 5227) found in reefs subjected to surges (Ref. 9311). Moves over great distances to feed on hard-shelled invertebrates (Ref. 9311).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: wrasse (English), viejita (Espanol), señorita (Espanol), vieja (Espanol)
 
Thalassoma grammaticum Gilbert, 1890


Sunset wrasse,     Green wrasse


Elongate, compressed body; 1 pair canines at front of top jaw, 1 pair on bottom, none at rear of jaws; preopercle edge smooth; dorsal fin VIII, 13-14; anal rays III, 11; pectoral rays 15-17 (usually 16); tail fin varying from slightly rounded in juveniles to strongly concave with long tips in large terminal males; lateral line unbroken, but bends abruptly down near end of soft dorsal fin; scales large (25 on lateral line), smooth; head scaleless except for a patch of small scales dorsally on opercle.


IP:  greenish yellow with faint light red bands on head; TP:  greenish to blue, head pinkish with narrow greenish bands across cheek and radiating from eye, a broad dark band across outer portion of pectoral fin; tail fin with purple stripes along top and bottom edges; dorsal and anal fins with purple stripe along base; juveniles greenish brown above, white below, those colors separated by a black lateral stripe that breaks into spots toward the rear and ends in a black spot at base of caudal fin.


Maximum size reaches 32 cm.

Inhabits coral and rocky reefs.

Depth: 0-65 m.

Southern Baja and the SW and central eastern Gulf of California to Ecuador,  most abundant at all the offshore islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Eastern Pacific: Mexico to Peru, including the ocean islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is endemic to the Eastern Pacific, and is found from southern Baja California and the southwestern and central eastern Gulf of California to northern Peru, including all the offshore Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 65 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, East Pacific endemic, Tropical Eastern Pacific (TEP) endemic

Regional Endemism: All species, TEP endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 32.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 320 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

32.0 cm TL (male/unsexed; (Ref. 9311))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 3 - 42 m (Ref. 9311)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This reef-associated species is found in reefs subjected to surges, generally to depths of 65 m. At Gulf of Chiriqui, Panamá, this fish was found in the zone of madreporic branching coral (Dominici-Arosemena and Wolff 2006).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 11 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 0.3 - 21
  Temperature range (°C): 26.928 - 27.666
  Nitrate (umol/L): 1.599 - 5.562
  Salinity (PPS): 32.938 - 33.371
  Oxygen (ml/l): 4.243 - 4.671
  Phosphate (umol/l): 0.327 - 0.628
  Silicate (umol/l): 2.028 - 4.148

Graphical representation

Depth range (m): 0.3 - 21

Temperature range (°C): 26.928 - 27.666

Nitrate (umol/L): 1.599 - 5.562

Salinity (PPS): 32.938 - 33.371

Oxygen (ml/l): 4.243 - 4.671

Phosphate (umol/l): 0.327 - 0.628

Silicate (umol/l): 2.028 - 4.148
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 3 - 42m.
From 3 to 42 meters.

Habitat: reef-associated. Solitatry (Ref. 5227). Inhabits reefs that are subjected to surges. Moves over great distances to feed on hard-shelled invertebrates. Not utilized for human consumption.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Reef (rock &/or coral), Reef only, Rocks, Corals, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

A solitary species (Ref. 5227) found in reefs subjected to surges (Ref. 9311). Moves over great distances to feed on hard-shelled invertebrates (Ref. 9311). Mobile-invertebrate feeder (Ref. 57615).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic worms, mobile benthic crustacea (shrimps/crabs), mobile benthic gastropods/bivalves, sea-stars/cucumbers/urchins
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thalassoma grammaticum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTTGTATTCGGCGCATGAGCCGGGATAGTAGGGACAGCCCTAAGCCTGCTCATTCGAGCAGAATTAAGCCAGCCCGGCGCCCTCCTTGGGGACGATCAGATCTATAACGTCATCGTTACAGCCCATGCATTTGTCATAATTTTCTTTATAGTAATACCAATTATGATCGGAGGCTTCGGAAACTGACTTATTCCCCTAATGATTGGGGCCCCTGACATGGCCTTCCCTCGTATGAACAATATAAGCTTTTGACTTCTTCCCCCCTCATTCCTGCTTCTTCTTGCCTCTTCTGGCGTTGAGGCGGGGGCCGGGACCGGATGGACAGTCTACCCGCCCTTAGCAGGTAACCTTGCCCACGCTGGTGCATCCGTTGACCTAACTATCTTCTCACTACATCTGGCAGGTATTTCATCAATTCTAGGTGCAATTAATTTCATTACAACCATTATTAATATGAAACCCCCAGCCATCTCTCAATACCAAACACCCCTTTTCGTATGGGCCGTTCTAATTACAGCAGTCCTTCTCCTCCTTTCCCTTCCAGTACTTGCTGCCGGCATTACAATGCTCCTCACAGACCGAAACCTAAACACTACCTTCTTCGACCCTGCCGGGGGAGGAGACCCAATTCTTTACCAACATCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Thalassoma grammaticum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Allen, G., Robertson, R., Rivera, F., Edgar, G., Zapata, F., Pollard, D., Cabanban, A.

Reviewer/s
Sadovy, Y., Craig, M.

Contributor/s

Justification
This species is widespread in the Eastern Pacific, and common in many parts of its range. There are no known major threats to this species, and no current indication of population decline. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is moderately common in many parts of its range.

This species was studied in different sites at Galapagos archipelago, with an overall mean abundance of 0.59 individuals per 500 m2 (Edgar et al. 2004). This fish was not found in surveys at Gulf of Papagayo (Dominici-Arosemena et al. 2005), Gulf Dulce (Figueroa 2001) or Catalinas Island (Espinoza and Salas 2005), in Costa Rica. According to Aburto-Oropeza and Balart (2001), T. grammaticum is a rare species at Los Islotes, Gulf of California, with an occurrence frequency below 10%.

In Cabo Pulmo, Mexico, this fish was considered abundant — more than 5% of the overall abundance registered — with a relative frequency between 75-100% (Villarreal-Cavazos et al. 2000). In Bahía de Navidad, México, this fish was not captured within 12 month-long field trips throughout a year (Rojo-Vázquez et al. 2001). At Gorgona Island coral reefs, Colombia (Zapata and Morales 1997), this species is less abundant, with a density of 0.0007 (±0.007) individuals per 10 m2, with an observational frequency of 1.2%. According to Robertson and Allen (1996), this fish was commonly collected and apparently abundant enough to have a resident population at Clipperton Atoll.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There are no major threats known for this species, although it is collected for the aquarium trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known conservation measures for this species. However, this species' distribution falls partially into a number of Marine Protected Areas in the Eastern Pacific region (WDPA 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Thalassoma grammaticum

Thalassoma grammaticum, or the Sunset wrasse, is a species of fish in the Labridae family.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!