Ulcina olrikii — Details

Arctic Alligatorfish learn more about names for this taxon

Overview

Comprehensive Description

Biology

Learn more about this article

Found on sand and mud bottoms, at temperatures mostly below 0°C, rarely to 2-3°C or more and salinities of 33-35 ppt (Ref. 4700). Benthic (Ref. 58426). Minimum depth reported at 7m (Ref. 5951). Feeds on small amphipods, ostracods and nemertine worms (Ref. 4700).

Andriashev, A.P. 1986 Agonidae. p. 1265-1268. In P.J.P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) Fishes of the North-eastern Atlantic and the Mediterranean. volume 3. UNESCO, Paris. (Ref. 4700) http://www.fishbase.org/references/FBRefSummary.php?id=4700&speccode=36

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Biology

Learn more about this article

The most abundant poacher in the Arctic Ocean

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Brownish, with darker bands or spots; posterior margin of dorsal and anal fins chalky white in males; One dorsal fin; Relatively short body, broad head; No supralateral plates; Nasal spines present, well developed; Short barbel on posterior end of maxilla (upper jaw)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Distribution

Learn more about this article

Canadian part of the Arctic Ocean, Gulf of Maine, Gulf of St. Lawrence

North-West Atlantic Ocean species (NWARMS) http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Nozères C., Archambault D., Chouinard P.-M., Gauthier J., Miller R., Parent E., Schwab P., Savard L., and Dutil J.-D. 2010. Identification guide for marine fishes of the estuary and northern Gulf of St. Lawrence and sampling protocols used during trawl surveys between 2004 and 2008. Can. Tech. Rep. Fish. Aquat. Sci. 2866: xi + 243 p http://www.marinespecies.org/aphia.php?p=sourcedetails&id=145051
Miller, Roberta. 2012. The museum collection database, Fisheries and Oceans Canada digital collections, Maurice Lamontagne Institute, Quebec http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=163928

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Arctic to Northwest Atlantic and Northwest to Northeast Pacific: Hudson Bay and Labrador in Canada and Greenland. Also in the Barents Sea, Kara Sea, White Sea and Siberia (Ref. 4700); Chukchi Sea, Bering Strait, Bering Sea and Anadyr Gulf (Ref. 6876).

Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251) http://www.fishbase.org/references/FBRefSummary.php?id=7251&speccode=942

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Arctic Ocean to Western Atlantic (Hudson Bay and Labrador, to Georges Bank, also in Greenland); also in the Barents Sea, Kara Sea, White Sea and Siberia

North-West Atlantic Ocean species (NWARMS) http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

National Distribution

Learn more about this article

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Arctic, North Pacific, and western North Atlantic.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Physical Description

Morphology

Learn more about this article

Dorsal spines (total): 0; Dorsal soft rays (total): 5 - 7; Analspines: 0; Analsoft rays: 5 - 7

Andriashev, A.P. 1986 Agonidae. p. 1265-1268. In P.J.P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) Fishes of the North-eastern Atlantic and the Mediterranean. volume 3. UNESCO, Paris. (Ref. 4700) http://www.fishbase.org/references/FBRefSummary.php?id=4700&speccode=36

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Size

Learn more about this article

Maximum size: 86 mm TL

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Max. size

Learn more about this article

8.6 cm TL (male/unsexed; (Ref. 4700))

Andriashev, A.P. 1986 Agonidae. p. 1265-1268. In P.J.P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) Fishes of the North-eastern Atlantic and the Mediterranean. volume 3. UNESCO, Paris. (Ref. 4700) http://www.fishbase.org/references/FBRefSummary.php?id=4700&speccode=36

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Diagnostic Description

Learn more about this article

Caudal fin rounded. Upper parts brownish-grey, with a few dark spots or bands, lower parts light (Ref. 4700).

Andriashev, A.P. 1986 Agonidae. p. 1265-1268. In P.J.P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) Fishes of the North-eastern Atlantic and the Mediterranean. volume 3. UNESCO, Paris. (Ref. 4700) http://www.fishbase.org/references/FBRefSummary.php?id=4700&speccode=36

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Type Information

Learn more about this article

Paratype for Aspidophoroides guentherii Bean
Catalog Number: USNM 37033
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): M. Healy
Year Collected: 1884
Locality: Alaska, United States, Pacific
Vessel: US Revenue Steamer Thomas Corwin

Paratype: Bean, T. H. 1885. Proceedings of the United States National Museum. 8 (487): 74.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Holotype for Aspidophoroides guentherii Bean
Catalog Number: USNM 37032
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Stoney
Year Collected: 1884
Locality: Alaska, United States, Pacific

Holotype: Bean, T. H. 1885. Proceedings of the United States National Museum. 8 (487): 74.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Ecology

Habitat

Environment

Learn more about this article

demersal; brackish; marine; depth range 7 - 520 m (Ref. 58496)

Parin, N.V., V.V. Fedorov and B.A. Sheiko 2002 An annotated catalogue of fish-like vertebrates and fishes of the seas of Russia and adjacent countries: Part 2. Order Scorpaeniformes. J. Ichthyol. 42(Suppl.1):S60-S135. (Ref. 58496) http://www.fishbase.org/references/FBRefSummary.php?id=58496&speccode=23989

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

benthic

North-West Atlantic Ocean species (NWARMS) http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Found on sand and mud bottoms, at temeratures mostly below 0°C, rarely to 2-3°C or more and salinities of 33-35 ppt.

North-West Atlantic Ocean species (NWARMS) http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Depth range based on 201 specimens in 1 taxon.
Water temperature and chemistry ranges based on 135 samples.

Environmental ranges
  Depth range (m): 0 - 420
  Temperature range (°C): -1.437 - 7.623
  Nitrate (umol/L): 0.373 - 33.771
  Salinity (PPS): 29.558 - 33.939
  Oxygen (ml/l): 5.688 - 9.022
  Phosphate (umol/l): 0.515 - 2.672
  Silicate (umol/l): 3.665 - 54.714

Graphical representation

Depth range (m): 0 - 420

Temperature range (°C): -1.437 - 7.623

Nitrate (umol/L): 0.373 - 33.771

Salinity (PPS): 29.558 - 33.939

Oxygen (ml/l): 5.688 - 9.022

Phosphate (umol/l): 0.515 - 2.672

Silicate (umol/l): 3.665 - 54.714

Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Public Domain

Source: Ocean Biogeographic Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Depth: 15 - 520m.
From 15 to 520 meters.

Habitat: demersal.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Arctic faunal region; Benthic, at depths of 7-520 m, usually < 100 m; Mostly on muddy and muddy-sandy substrate

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Migration

Learn more about this article

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Trophic Strategy

Learn more about this article

Found on sand and mud bottoms, at temperatures mostly below 0°C, rarely to 2-3°C or more and salinities of 33-35 ppt (Ref. 4700). Benthic (Ref. 58426). Feeds on small amphipods, ostracods and nemertine worms (Ref. 4700). It is preyed upon by halibut (Ref. 5951).

Andriashev, A.P. 1986 Agonidae. p. 1265-1268. In P.J.P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) Fishes of the North-eastern Atlantic and the Mediterranean. volume 3. UNESCO, Paris. (Ref. 4700) http://www.fishbase.org/references/FBRefSummary.php?id=4700&speccode=36

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Feed on gammarid amphipods, polychaete and nemertine worms, ostracods.; Eaten by halibuts (Hippoglossus) and other bottom fishes

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Life History and Behavior

Life Cycle

Learn more about this article

Little is known; Eggs demersal; Counts of well developed eggs in ovaries range from 110 to 260

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aspidophoroides olrikii

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 10 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTGGGCACAGCTCTAAGCCTCCTAATTCGAGCTGAGCTGAGTCAACCCGGAGCCCTTTTAGGGGACGACCAAATTTATAATGTGATTGTTACGGCCCATGCTTTCGTAATAATTTTCTTTATAGTAATGCCCATCATAATCGGGGGCTTCGGAAACTGACTTATTCCTCTAATGATCGGGGCTCCCGACATGGCATTTCCTCGAATAAATAACATAAGCTTTTGGCTTTTGCCCCCCTCCTTCCTACTACTTCTCGCTTCTTCAGGGGTAGAAGCAGGAGCCGGAACTGGTTGAACAGTTTATCCCCCTCTCGCTGGTAACCTGGCACATGCGGGAGCCTCTGTTGACCTGACAATTTTCTCTTTACATCTAGCAGGAATCTCCTCCATTCTCGGGGCAATTAATTTTATCACAACCATCATTAACATAAAACCCCCTGCTATTTCTCAATACCAAACCCCTCTTTTCGTGTGGTCCGTTCTTATCACAGCTGTCTTACTGCTTCTCGCCCTTCCCGTCCTTGCTGCTGGCATTACGATGCTTTTAACAGACCGTAATCTTAACACCACCTTTTTCGACCCAGCAGGAGGTGGAGACCCTATTCTTTATCAACATCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Statistics of barcoding coverage: Aspidophoroides olrikii

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 26
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Conservation

Conservation Status

National NatureServe Conservation Status

Learn more about this article

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

NatureServe Conservation Status

Learn more about this article

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Threats

Learn more about this article

Not Evaluated

IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006. http://www.fishbase.org/references/FBRefSummary.php?id=57073

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Wikipedia

Ulcina olrikii

Learn more about this article

Ulcina olrikii, the Arctic alligatorfish, is a species of poacher native to the northern oceans where it occurs at depths of from 7 to 520 metres (23 to 1,710 ft). This species grows to a length of 8.6 centimetres (3.4 in) TL. This species is the only known member of its genus.

References

Froese, Rainer, and Daniel Pauly, eds. (2012). "Ulcina olrikii" in FishBase. December 2012 version.

This Scorpaeniformes article is a stub. You can help Wikipedia by expanding it.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!