Overview

Comprehensive Description

Biology

Found on sand and mud bottoms, at temperatures mostly below 0°C, rarely to 2-3°C or more and salinities of 33-35 ppt (Ref. 4700). Benthic (Ref. 58426). Minimum depth reported at 7m (Ref. 5951). Feeds on small amphipods, ostracods and nemertine worms (Ref. 4700).
  • Andriashev, A.P. 1986 Agonidae. p. 1265-1268. In P.J.P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) Fishes of the North-eastern Atlantic and the Mediterranean. volume 3. UNESCO, Paris. (Ref. 4700)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Arctic to Northwest Atlantic and Northwest to Northeast Pacific: Hudson Bay and Labrador in Canada and Greenland. Also in the Barents Sea, Kara Sea, White Sea and Siberia (Ref. 4700); Chukchi Sea, Bering Strait, Bering Sea and Anadyr Gulf (Ref. 6876).
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Arctic, North Pacific, and western North Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 5 - 7; Analspines: 0; Analsoft rays: 5 - 7
  • Andriashev, A.P. 1986 Agonidae. p. 1265-1268. In P.J.P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) Fishes of the North-eastern Atlantic and the Mediterranean. volume 3. UNESCO, Paris. (Ref. 4700)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 86 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

8.6 cm TL (male/unsexed; (Ref. 4700))
  • Andriashev, A.P. 1986 Agonidae. p. 1265-1268. In P.J.P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) Fishes of the North-eastern Atlantic and the Mediterranean. volume 3. UNESCO, Paris. (Ref. 4700)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Caudal fin rounded. Upper parts brownish-grey, with a few dark spots or bands, lower parts light (Ref. 4700).
  • Andriashev, A.P. 1986 Agonidae. p. 1265-1268. In P.J.P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) Fishes of the North-eastern Atlantic and the Mediterranean. volume 3. UNESCO, Paris. (Ref. 4700)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Aspidophoroides guentherii Bean
Catalog Number: USNM 37033
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): M. Healy
Year Collected: 1884
Locality: Alaska, United States, Pacific
Vessel: US Revenue Steamer Thomas Corwin
  • Paratype: Bean, T. H. 1885. Proceedings of the United States National Museum. 8 (487): 74.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Holotype for Aspidophoroides guentherii Bean
Catalog Number: USNM 37032
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Stoney
Year Collected: 1884
Locality: Alaska, United States, Pacific
  • Holotype: Bean, T. H. 1885. Proceedings of the United States National Museum. 8 (487): 74.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; brackish; marine; depth range 7 - 520 m (Ref. 58496)
  • Parin, N.V., V.V. Fedorov and B.A. Sheiko 2002 An annotated catalogue of fish-like vertebrates and fishes of the seas of Russia and adjacent countries: Part 2. Order Scorpaeniformes. J. Ichthyol. 42(Suppl.1):S60-S135. (Ref. 58496)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 201 specimens in 1 taxon.
Water temperature and chemistry ranges based on 135 samples.

Environmental ranges
  Depth range (m): 0 - 420
  Temperature range (°C): -1.437 - 7.623
  Nitrate (umol/L): 0.373 - 33.771
  Salinity (PPS): 29.558 - 33.939
  Oxygen (ml/l): 5.688 - 9.022
  Phosphate (umol/l): 0.515 - 2.672
  Silicate (umol/l): 3.665 - 54.714

Graphical representation

Depth range (m): 0 - 420

Temperature range (°C): -1.437 - 7.623

Nitrate (umol/L): 0.373 - 33.771

Salinity (PPS): 29.558 - 33.939

Oxygen (ml/l): 5.688 - 9.022

Phosphate (umol/l): 0.515 - 2.672

Silicate (umol/l): 3.665 - 54.714
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 15 - 520m.
From 15 to 520 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found on sand and mud bottoms, at temperatures mostly below 0°C, rarely to 2-3°C or more and salinities of 33-35 ppt (Ref. 4700). Benthic (Ref. 58426). Feeds on small amphipods, ostracods and nemertine worms (Ref. 4700). It is preyed upon by halibut (Ref. 5951).
  • Andriashev, A.P. 1986 Agonidae. p. 1265-1268. In P.J.P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) Fishes of the North-eastern Atlantic and the Mediterranean. volume 3. UNESCO, Paris. (Ref. 4700)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aspidophoroides olrikii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTGGGCACAGCTCTAAGCCTCCTAATTCGAGCTGAGCTGAGTCAACCCGGAGCCCTTTTAGGGGACGACCAAATTTATAATGTGATTGTTACGGCCCATGCTTTCGTAATAATTTTCTTTATAGTAATGCCCATCATAATCGGGGGCTTCGGAAACTGACTTATTCCTCTAATGATCGGGGCTCCCGACATGGCATTTCCTCGAATAAATAACATAAGCTTTTGGCTTTTGCCCCCCTCCTTCCTACTACTTCTCGCTTCTTCAGGGGTAGAAGCAGGAGCCGGAACTGGTTGAACAGTTTATCCCCCTCTCGCTGGTAACCTGGCACATGCGGGAGCCTCTGTTGACCTGACAATTTTCTCTTTACATCTAGCAGGAATCTCCTCCATTCTCGGGGCAATTAATTTTATCACAACCATCATTAACATAAAACCCCCTGCTATTTCTCAATACCAAACCCCTCTTTTCGTGTGGTCCGTTCTTATCACAGCTGTCTTACTGCTTCTCGCCCTTCCCGTCCTTGCTGCTGGCATTACGATGCTTTTAACAGACCGTAATCTTAACACCACCTTTTTCGACCCAGCAGGAGGTGGAGACCCTATTCTTTATCAACATCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Aspidophoroides olrikii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 30
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Arctic alligatorfish

The Arctic alligatorfish[2] (Aspidophoroides olrikii) is a fish in the family Agonidae (poachers).[3] It was described by C.F. Lütken in 1877.[4] It is a marine and brackish-water dwelling fish which is known from the Arctic, the northwestern Atlantic and northwestern and northeastern Pacific Ocean, including Canada, Greenland, Siberia, the Barents Sea, the White Sea, the Kara Sea, the Chukchi Sea, the Bering Sea, the Bering Strait, and the Anadyr Gulf. It dwells at a depth range of 7-520 metres, in salinities of 30-35 ppt, and leads a benthic lifestyle, inhabiting sand and mud bottoms. It mostly lives in temperatures below 0°C, but on rare occasions has been found in temperatures of 2-3°C. Males can reach a maximum total length of 8.6 centimetres.[3]

The diet of the Arctic alligatorfish consists of amphipods such as Dyopedos porrectus and Paradulichia typica, bivalves such as Macoma calcarea, ostracods, isopods, and nemertine worms.[5]

References[edit]

  1. ^ Synonyms of Aspidophoroides olrikii at www.fishbase.org.
  2. ^ Common names for Aspidophoroides olrikii at www.fishbase.org.
  3. ^ a b Aspidophoroides olrikii at www.fishbase.org.
  4. ^ Lütken, C. F., 1877 [ref. 17566] Korte bidrag til nordisk Ichthyographi. I. Foreløbige Meddelelser om nordiske Ulkefiske (Cottoidei). Videnskabelige Meddelelser fra den Naturhistoriske Forening i Kjøbenhavn, Aaret 1876-1877: 355-388 + 72-98.
  5. ^ Food items reported for Aspidophoroides olrikii at www.fishbase.org.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!