Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Forms aggregations 1 to 2 m above coral or rocky bottoms along edges of lagoon, channel, and outer reef slopes. Feeds on zooplankton in the water column. Sometimes form large schools (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is present in the Eastern Indian Ocean, from the Rowely Shoals (Myers 1991), Similan Islands, Andaman Sea and Christmas Island. In the Western Pacific, it occurs from the Ryukyu Islands (Japan), Taiwan, Thailand, Philippines, Papua New Guinea (Lieske and Myers 1994), Palau, Indonesia to the Great Barrier Reef (Australia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific: southern Japan to Indonesia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Indian Ocean: Rowely Shoals (Ref. 1602), Similan Islands, Andaman Sea and Christmas Island. Western Pacific: Ryukyu Islands, Taiwan, Philippines, Papua New Guinea (Ref. 9710), Palau, Indonesia, and Great Barrier Reef.
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)   http://www.fishbase.org/references/FBRefSummary.php?id=9823&speccode=4844 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: Andaman Sea to Bali.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 9; Analspines: 3; Analsoft rays: 9 - 10
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 150 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

15.0 cm SL (male/unsexed; (Ref. 9823))
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)   http://www.fishbase.org/references/FBRefSummary.php?id=9823&speccode=4844 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Males complexly and brightly colored than the juvenile-female phase; adults with blue-rimmed scales on mid-side of the body; a narrow diagonal bluepurple band at pectoral base and extending below. Median and pelvic fins with light blue or blue green rays. Lateral line interrupted. Median predorsal scales 6. Caudal fin rounded (small individuals) to rhomboidal.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species forms aggregations pme to two m above coral or rocky bottoms and coral rubble along the edges of lagoon, channel, and outer reef slopes. It feeds on zooplankton in the water column. It sometimes forms large schools (Kuiter and Tonozuka 2001). The habitat for this species is coral reefs, and is found at depths between 2-30 m (Westneat 2001). The maximum size 15 cm TL.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 2 - 30 m (Ref. 9823), usually 5 - 20 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 32 specimens in 1 taxon.
Water temperature and chemistry ranges based on 12 samples.

Environmental ranges
  Depth range (m): 2 - 34
  Temperature range (°C): 28.170 - 29.336
  Nitrate (umol/L): 0.062 - 0.596
  Salinity (PPS): 32.279 - 34.449
  Oxygen (ml/l): 4.338 - 4.663
  Phosphate (umol/l): 0.071 - 0.327
  Silicate (umol/l): 1.174 - 4.452

Graphical representation

Depth range (m): 2 - 34

Temperature range (°C): 28.170 - 29.336

Nitrate (umol/L): 0.062 - 0.596

Salinity (PPS): 32.279 - 34.449

Oxygen (ml/l): 4.338 - 4.663

Phosphate (umol/l): 0.071 - 0.327

Silicate (umol/l): 1.174 - 4.452
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 30m.
From 2 to 30 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154). Feeds 1 to 2 m above the substratum.
  • Randall, J.E. and S. Shen 1978 A review of the labrid fishes of the genus Cirrhilabrus from Taiwan, with description of a new species. Bull. Inst. Zool., Acad. Sinica 17(1):13-24. (Ref. 2745)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Diplosentis Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cirrhilabrus cyanopleura

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTCGTGTTTGGTGCTTGAGCTGGAATAGTTGGCACAGCCTTAAGCCTTCTAATTCGAGCAGAACTTAGTCAACCAGGTKCACTCCTGGGCGACGATCAGATCTATAATGTAATCGTCACTGCACATGCTTTTGTTATAATTTTCTTTATGGTAATGCCTATCATAATTGGAGGGTTTGGAAACTGACTTATTCCTTTGATGATCGGAGCCCCCGACATAGCATTTCCTCGAATGAATAATATGAGTTTCTGACTTCTGCCACCATCCTTCCTCCTCCTTCTTGCCTCATCAGGGGTTGAAGCCGGAGCAGGAACAGGTTGGACTGTTTACCCTCCCTTAGCAGGCAATCTCGCACACGCTGGTGCCTCTGTGGATTTAACTATTTTTTCCCTCCACCTTGCAGGTATCTCCTCAATTCTAGGTGCTATTAATTTTATTACAACTATTATTAATATAAAACCCCCASCCATCTCTCAGTATCAAACACCTTTGTTTGTTTGAGCCGTATTAATTACTGCTGTCCTGCTCCTTCTCTCACTCCCAGTCCTAGCTGCCGGAATTACAATACTTTTAACTGATCGAAACCTCAATACCACCTTTTTTGACCCTGCTGGTGGAGGGGACCCTATTCTTTACCAACATTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cirrhilabrus cyanopleura

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Cabanban, A. & Choat, J.H.

Reviewer/s
Liu, M. & Carpenter, K.E.

Contributor/s

Justification
This species is exploited for the aquarium trade and its habitat is at risk from human activities including blast-fishing, sedimentation, and pollution. The populations are probably declining due to collection for the aquarium trade and habitat destruction. However, this species has a short generation length, is a small fish and common. The effects of collection on the population are unknown. It is listed as Data Deficient.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is no population information. This is a relatively common species. The populations are probably declining due to collection for the aquarium trade and habitat destruction.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Threats to this species include habitat destruction on shallow reefs from collection for the aquarium trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific conservation measures in place for this species. Its distribution overlaps several marine protected areas within its range. The Marine Aquarium Council sets standards and promotes certification of the aquarium industry around the world. There are also national regulations on operations and export quotas for aquiring fishes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cirrhilabrus cyanopleura

The blueside wrasse, Cirrhilabrus cyanopleura, is a species of wrasse native to the eastern Indian Ocean and the western Pacific Ocean. It is found on reefs in schools swimming 1 to 2 m (3.3 to 6.6 ft) above the bottom. It occurs at depths from 2 to 30 m (6.6 to 98 ft), most often between 5 and 20 m (16 and 66 ft). This species can reach a standard length of 15 cm (5.9 in). It can be found in the aquarium trade.[2]

References[edit]

  1. ^ Cabanban, A. & Choat, J.H. 2010. Cirrhilabrus cyanopleura. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 03 November 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Cirrhilabrus cyanopleura" in FishBase. August 2013 version.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Cirrhilabrus lyukyuensis

Cirrhilabrus lyukyuensis is a Wrasse from the Eastern Indian Ocean. It occasionally makes its way into the aquarium trade. It grows to a size of 15 cm in length.

References


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!