Overview

Comprehensive Description

Biology

In its natural range, it occurs in rivers with marked water-level fluctuations and overwinters in middle and lower stretches. Forages in shallow (0.5-1.0 m deep) and warm (over 21°C) backwaters, lakes and flooded areas with slow current. Breeds in rivers or tributaries over shallow rapids with gravel or sand bottom, high current (0.5-1.7 m/s), turbid water, temperatures above 15°C (usually 18-26°C) and high oxygen concentrations (Ref. 59043). Migrates upstream to breed; egg and larva float downstream to floodplain zones. An active species well known for its habit of leaping clear of the water when disturbed (Ref. 7248). Swims just beneath the water surface (Ref. 5258). Stocked in large rivers and almost all still water bodies as lakes and ponds. Often escapes from fish farms. In aquaculture, it can survive brackish water (up to 7 ppt) when released into estuaries and coastal lakes (Ref. 59043). Requires standing or slow-flowing conditions such as in impoundments or the backwaters of large rivers. Feeds on phytoplankton and zooplankton (Ref. 30578, 10294), from about 1.5 cm SL feeding only on phytoplankton while larvae and small juveniles preying on zooplankton (Ref. 59043). Juveniles and adults form large schools during spawning season. Undertakes long distance upriver migration at start of a rapid flood and water-level increase, able to leap over obstacles up to 1 m. Spawns in upper water layer or even at surface during floods when the water level increases by 50-120 cm above normal level. Spawning ceases if conditions change (especially sensitive to water-level fall, reduced turbidity and increased current velocity) and resumes again when water level increases. After spawning, adults migrate for foraging habitats, In autumn, adults move to deeper places in main course of river where they remain without feeding. Larvae drift downstream and settle in floodplain lakes, shallow shores and backwaters with little or no current (Ref. 59043). Utilized fresh for human consumption and also introduced to many countries where its ability to clean reservoirs and other waters of clogging algae is appreciated even more than its food value (Ref. 9987). It is among 3 or 4 species of cyprinids whose world production in aquaculture exceeds 1 million tons per year (Ref. 30578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This a widespread species throughout China from Heilongjiang, Yangtze and Pearl River basins. Also recorded in eastern Russia (Amur River) and from Mongolia. Introduced around the world for aquaculture and control of algal blooms. Several countries report adverse ecological impact after introduction.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Silver carp, Hypophthalmichthys molitrix, are native to eastern Asia and are commonly found in northeastern China and Siberia. They have also been introduced to other areas of the world, and are now considered invasive to North America. Silver carp have been reported in 16 states in the United States and are well established in the Mississippi River Basin.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native )

  • 2005. "Silver Carp Hypophthalmichthys molitrix (Valenciennes 1844)" (On-line). USGS - Southeast Ecological Science Center. Accessed April 02, 2010 at http://fl.biology.usgs.gov/Carp_ID/html/hypophthalmichthys_molitrix.html.
  • Luna, S., N. Baily. 2010. "Hypophthalmichthys molitrix (Valenciennes, 1844) Silver carp" (On-line). Fish Base. Accessed February 18, 2010 at http://www.fishbase.org/Summary/SpeciesSummary.php?ID=274.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Native to several major Pacific drainages in eastern Asia from the Amur River south through much of the eastern half of China to Pearl River, possibly including northern Vietnam (see Fuller et al. 1999). Has been collected in Alabama, Arizona, Arkansas, Colorado, Florida, Illinois, Indiana, Kansas, Kentucky, Louisiana, Missouri, and Tennessee; Apparently established in Louisiana (Douglas et al. 1996, Douglas and Jordan 2002) and possibly in Illinois (Fuller et al. 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Europe and Asia: Native to most major Pacific dainages of East Asia from Amur to Xi Jiang, China (Ref. 59043). China and Eastern Siberia. Introduced around the world for aquaculture and control of algal blooms. Several countries report adverse ecological impact after introduction (Ref. 1739). Often confused with Hypophthalmichthys nobilis (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Silver carp are olive green in color on their dorsal side and silver on the ventral side. They have a deep, laterally compressed body and a large head. Their eyes are located near the ventral side, which makes them easily distinguishable from other carp. Both dorsal and anal fins are present, but an adipose fin is lacking. They have 1 to 3 dorsal spines, 1 to 3 anal spines, 6 to 7 soft dorsal rays, and 10 to 14 sot anal rays. The lateral line is approximately 80 to 130 scales in length. They have numerous thin gill rakers (100 or more). Silver carp are also characterized by a smooth ventral keel on the abdomen that runs from the anus to the gill membrane. Silver carp vary considerably in size; most are relatively small (10 to 30 cm), but some can grow as much as 1 m in length and weigh in excess of 60 pounds (27 kg).

Range mass: 27 (high) kg.

Range length: 105 (high) cm.

Average length: 18 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dorsal spines (total): 1 - 3; Dorsal soft rays (total): 6 - 7; Anal spines: 1 - 3; Analsoft rays: 10 - 14
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

105 cm TL (male/unsexed; (Ref. 40637)); max. published weight: 50.0 kg (Ref. 30578)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body olivaceous to silvery. Barbels absent. Keels extend from isthmus to anus. Edge of last simple dorsal ray not serrated. Branched anal rays 12-13.5 (Ref. 13274). Differs from Hypophthalmichthys nobilis by having sharp scaleless keel from pectoral region to anal origin, 650-820 long, slender gill rakers, head length 24-29% SL, and plain pale coloration, greenish grey above, whitish below (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Amur River Benthopelagic Habitat

This taxon is one of a number of benthopelagic species in the Amur River system. Benthopelagic river fish are found near the bottom of the water column, feeding on benthos and zooplankton

The persistence of mercury contamination in Amur River bottom sediments is a major issue, arising from historic cinnabar mining in the basin and poor waste management practises, especially in the communist Soviet era, where industrial development was placed ahead of sound conservation practises.

Other large benthopelagic river fish of the Amur Basin is the 200 cm yellowcheek (Elopichthys bambusa) and the 122 cm Mongolian redfin (Chanodichthys mongolicus)


Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Yangtze River Benthopelagic Habitat

This taxon is one of a number of benthopelagic species in the Yangtze River system. Benthopelagic fish inhabit the water column niche immediately above the bottom, feeding on benthos and zooplankton.

The upper Yangtze basin consists chiefly of Paleozoic limestone and terrigenous sedimentary rock, with some granitic material. The most downstream element of the upper Yangtze basin is often termed the Sichuan Basin; here the Yangtze cuts through Triassic and Permian material before entering the Three Gorges. The Three Gorges area is a stretch of the Yangtze that runs approximately 660 kilometers, terminating at the site of the Three Gorges Dam. Prior to construction of the dam, the Three Gorges area was a site of exceptional natural beauty; after dam construction the gorge areas were filled with approximately 100 meters in depth of Yangtze water, and considerable amounts of the watershed were graded.

The lower Yangtze basin consists of anabranching river structures and Pleistocene coastal terraces. Prior to development of the Three Gorges Dam, the Yangtze Delta was replenished with a copious sediment load reaching the river mouth; however, the dam has now severely limited the natural flow and deposition of sediment to the delta region. Consequently, the integrity of the delta is been compromised, with scouring exceeding deposition, and the very stability of the delta is endangered.

Lower and middle basins of the Yangtze carry heavy pollutant loads. In the lower Yangtze basin nitrate levels are high, measuring at about 1000 tons per day at Datong; these levels accrue from high applications of chemical fertilizer applied and also considerable loadings of untreated sewage due to the large human population of the basin, with correspondingly little infrastructure for sewage treatment.

Heavy metal concentrations are also high in the lower Yangtze, with measurements of dissolved lead at 0.078 microgram/liter; cadmium (0.024 microgram/liter), chromium (0.57 microgram/liter), copper (1.9 microgram/liter), and nickel (0.50 microgram/liter). Levels of dissolved arsenic have been measured at 3.3 microgram/liter) and zinc at 1.5 microgram/liter), both notably higher by factors of 5.5 and 2.5 respectively than other typical large world rivers. In Yangtze River suspended sediment, arsenic comprises 31 microgram/gram, lead comprises 83 microgram/gram, and nickel comprises 52 micrograms/gram of sediment content

A number of other benthopelagic associates are found in the Yangtze, including: Anabarilius polylepis, Bangana rendahli, Pseudogyrinocheilus prochilus, Sinocyclocheilus grahami and Siniperca roulei. The demersal fish Silurus meridionalis also is found as a Yangtze River endemic species.
Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 2 people

Average rating: 5.0 of 5

Habitat and Ecology

Habitat and Ecology
Feeds on phytoplankton and zooplankton. In its natural range, it migrates upstream to breed; egg and larva float downstream to floodplain zones. An active species well known for its habit of leaping clear of the water when disturbed. Swims just beneath the water surface. Larvae and small juveniles feed on zooplankton; from 15 mm Standard length (SL) only feeds on phytoplankton. Very sensitive to low temperature (below 5°C) and oxygen deficit.

Dams have greatly impacted the species reproductive success. The Amur populations are thought not to have yet been impacted (M. Kottelat pers. comm. 2011), however populations in China have declined greatly as a result of the widespread development of dams.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Silver carp live in freshwater in temperate (6 to 28 °C) to subtropical climates. They are commonly found in impoundments or backwaters of large slow flowing rivers or large lakes. Silver carp are benthopelagic, but they often swim near the surface of the water and are well known for breaching the surface. They can tolerate brackish waters (up to 12 ppt) as well as low dissolved oxygen content (3 mg/l).

Habitat Regions: temperate ; freshwater

Aquatic Biomes: benthic ; lakes and ponds; rivers and streams

  • 2010. "Fisheries and Aquaculture Department : Hypophthalmichthys molitrix" (On-line). Food and Agriculture Organization of the United Nations. Accessed March 16, 2010 at http://www.fao.org/fishery/culturedspecies/Hypophthalmichthys_molitrix/en.
  • 2007. "Hypophthalmichthys molitrix - Silver Carp" (On-line). Aquatic Nuisance Species Research Program. Accessed April 02, 2010 at http://el.erdc.usace.army.mil/ansrp/ANSIS/html/hypophthalmichthys_molitrix_silver_carp.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

benthopelagic; potamodromous (Ref. 51243); freshwater; depth range 0 - 20 m (Ref. 6898)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Silver carp are filter feeders, feeding primarily on phytoplankton. Using specialized gill rakers covered with a thick matrix of calcified substances, silver carp are able to filter out the very smallest organisms (ranging in size from 8 to 100 micrometers). However, only a small part of their diet consists of zooplankton and detritus. Silver carp may also eat small arthropods and algea.

Animal Foods: aquatic crustaceans; zooplankton

Plant Foods: algae; phytoplankton

Other Foods: detritus

Foraging Behavior: filter-feeding

Primary Diet: planktivore

  • Cremer, M., R. Smitherman. 1980. Food-Habits and Growth of Silver and Bighead Carp in Cages and Ponds. Aquaculture, 20/1: 57-64.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Silver carp are considered invasive in North America. They were initially introduced into the United States in the 1970’s to control plankton blooms but have subsequently spread into 16 states after escaping from aquaculture centers. Silver carp can adapt to many different environments and can grow very quickly. They can consume 2 to 3 times their body weight in plankton each day. In controlled experiments, silver carp gained 2.7 g/day when fed a large diet. Because of their large size and voracious appetite, silver carp are able to out-compete many other species of fish.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Adult silver carp do not have any natural predators. However, fry are subject to predation from other fish and possibly birds.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Trichodinosis. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Myxobolus Infection 4. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Myxobolus Infection 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Enteric Redmouth Disease. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dactylogyrus Gill Flukes Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bothriocephalus Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Anchorworm Disease (Lernaea sp.). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Like many other fish, silver carp use their lateral line system to detect motions and vibrations. As filter feeders, however, they do not rely as heavily on their lateral line system as do predatory fish. Silver carp also utilize their senses of sight and smell. Reproduction is often cued by increases in water temperature as well as olfactory cues.

Communication Channels: visual ; chemical

Perception Channels: visual ; vibrations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Eggs of silver carp reach maturity when they are about 3.2 to 4.7 mm in size. Young enter the larval stage about 68 hours after hatching. During the larval stage, fry are vulnerable and inefficient feeders. After about 5 months, fry have grown to a size of 8 to 12 cm in body length and have become more efficient feeders. Silver carp reach maturity at 4 to 6 years of age, at which point they are capable of reproduction.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

With substantial food sources and few natural predators, silver carp can grow quite large and can live many years. Silver carp may live as long as 20 years in the wild, and may be capable of living longer.

Range lifespan

Status: wild:
20 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Silver carp generally reproduce during the spring or summer. Reproduction is primarily cued by increased water temperature. Like other species of carp, silver carp participate in broadcast spawning. During spawning, a female releases eggs and males fertilize them within the water column. A single female can carry as many as 2 million eggs.

Mating System: polygynandrous (promiscuous)

Spawning of silver carp takes place upstream and generally occurs in spring or summer. Optimal water temperatures for spawning range from 22 to 28 °C. Females release eggs in the water column, where they are then fertilized by many males. Fertilized eggs float downstream to floodplain zones where they absorb water and eventually settle to hatch. Silver carp reach sexual maturity at 4 to 6 years of age.

Breeding interval: Silver carp breed once yearly.

Breeding season: Spawning of silver carp occurs during spring or early summer.

Range age at sexual or reproductive maturity (female): 4 to 6 years.

Range age at sexual or reproductive maturity (male): 4 to 6 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

Silver carp do not demonstrate parental investment in their offspring. After eggs are released into and fertilized in the water column, silver carp leave the area and do not return.

Parental Investment: no parental involvement

  • 2010. "Fisheries and Aquaculture Department : Hypophthalmichthys molitrix" (On-line). Food and Agriculture Organization of the United Nations. Accessed March 16, 2010 at http://www.fao.org/fishery/culturedspecies/Hypophthalmichthys_molitrix/en.
  • 2005. "Silver Carp Hypophthalmichthys molitrix (Valenciennes 1844)" (On-line). USGS - Southeast Ecological Science Center. Accessed April 02, 2010 at http://fl.biology.usgs.gov/Carp_ID/html/hypophthalmichthys_molitrix.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hypophthalmichthys molitrix

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC4364-08|NC_010156|Hypophthalmichthys molitrix| ACACGCTGATTCTTTTCTACAAACCACAAAGACATTGGTACCCTTTATCTTGTATTTGGTGCCTGAGCCGGAATAGTGGGAACCGCCCTA---AGCCTTCTCATTCGAGCCGAACTAAGCCAACCCGGATCACTTCTGGGCGAT---GACCAAATTTATAATGTTATTGTTACTGCCCATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATCCTTATTGGAGGGTTTGGAAACTGACTCGTACCCCTAATG---ATTGGGGCACCTGATATAGCATTCCCACGAATAAATAATATAAGCTTTTGACTCCTACCCCCATCTTTCCTTCTACTACTAGCCTCTTCTGGTGTCGAGGCCGGGGCCGGAACAGGATGAACAGTTTATCCCCCACTCGCGGGTAATCTTGCCCACGCAGGAGCATCCGTAGACCTA---ACAATTTTCTCTCTTCACCTAGCAGGTGTGTCATCAATTTTAGGAGCAATTAACTTCATCACCACAACTATTAATATAAAACCACCAGCCATTTCTCAATATCAAACACCTCTCTTTGTTTGAGCCGTGCTCGTAACAGCCGTGCTTCTTCTCTTATCCCTACCAGTTTTAGCTGCT---GGAATTACAATACTCCTTACAGACCGTAATCTTAATACCACATTCTTTGACCCAGCAGGGGGAGGAGACCCAATCCTATATCAACACCTATTCTGATTCTTTGGTCACCCAGAAGTTTACATTCTTATTTTACCTGGATTTGGAATCATTTCACACGTTGTAGCCTACTACGCAGGTAAAAAA---GAACCATTCGGCTACATAGGAATAGTCTGAGCTATAATAGCTATCGGTCTCCTAGGATTTATTGTATGGGCCCATCACATGTTTACTGTTGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypophthalmichthys molitrix

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Species: 9
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Zhao, H.

Reviewer/s
Allen, D., Cui, K., Zhou, W. & Chen, X.-Y.

Contributor/s
Kottelat, M.

Justification
In its natural range, the species has been impacted by dams, pollution, and overfishing. Dams have greatly impacted the species reproductive success. The Amur populations are thought not to have yet been impacted (M. Kottelat pers. comm. 2011), however populations in China have declined greatly as a result of the widespread development of dams. Population declines in the natural population have been significant in the Chinese parts of its range.

It is assessed as Near Threatened due the the scale of wild population decline in China, as it is suspected to be close to meeting a threatened category under population decline (category A2). Monitoring of population trends and reproductive success in the wild is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Due to their rapid growth rate and worldwide popularity, silver carp are not considered threatened. They are often sold for human consumption and are also used for cleaning waters of algael blooms.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The natural population of the species has declined in its native range in China, however it has been widely introduced throughout China and to other countries, including Malaysia.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
In its natural range, the species has been impacted by dams, pollution, and overfishing. Dams and pollution destroy the habitat ecology, reproductive success. Dams have greatly impacted the species reproductive success. The Amur populations are thought not to have yet been impacted (M. Kottelat pers. comm. 2011), however populations in China have declined greatly as a result of the widespread development of dams. Population declines in the natural population have been significant in the Chinese parts of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The wild population should be monitored.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The lasting effects of silver carp as invasive spices on local ecosystems remains to be seen.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Silver carp are becoming increasing popular sources of food. They are also commonly used to clear algal blooms. Harvesting of silver carp increased from 1.9 million tons in 1993 to 4.1 million tons in 2003. Because silver carp do not require supplementary feed like other species of farm grown fish, they have become popular worldwide.

Positive Impacts: food ; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

fisheries: commercial; aquaculture: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Silver carp

Juvenile
Silver carp: 44.5 cm, 1.08 kg

The silver carp (Hypophthalmichthys molitrix) is a species of freshwater cyprinid fish, a variety of Asian carp native to north and northeast Asia. It is cultivated in China. Pound for pound, more silver carp are produced worldwide in aquaculture than any other species. Silver carp are usually farmed in polyculture with other Asian carps, or sometimes Indian carps or other species. It has been introduced to, or spread into via connected waterways, at least 88 countries around the world. The most common reason for importation was for use in aquaculture, but enhancement of wild fisheries and water quality control were also important reasons for importation.[1]

Contents

Diet

The silver carp is a filter feeder, and possesses a remarkably specialized apparatus capable of filtering particles as small as 4 µm. The gill rakers are fused into a sponge-like filter, and an epibranchial organ secretes mucus which assists in trapping small particles. A strong buccal pump forces water through this filter. Silver carp, like all Hypophthalmichthys species, have no stomachs; they are thought to feed more or less constantly. Silver carp are thought to feed largely on phytoplankton; they also consume zooplankton and detritus. Because of their plankton-feeding habits, there is concern they will compete with native planktivorous fishes, which in North America include paddlefish (Polyodon spathula), gizzard shad (Dorosoma cepedianum), and young fish of almost all species.

Because they feed on plankton, they are sometimes successfully used for controlling water quality, especially in the control of noxious blue-green algae (cyanobacteria). However, these efforts are sometimes not successful. Certain species of blue-green algae, notably the often toxic Microcystis, can pass through the gut of silver carp unharmed, and pick up nutrients while in the gut. Thus, in some cases, blue-green algae blooms have been exacerbated by silver carp. Also, Microcystis has been shown to produce more toxins in the presence of silver carp. Silver carp, which have natural defenses to their toxins, sometimes can contain enough algal toxins in their systems that they become hazardous to eat.[2]

Sport fishing

Silver carp are filter feeders, and thus are difficult to catch on typical hook and line gear. Special methods have been developed for these fish, the most important being the "suspension method", usually consisting of a large dough ball that disintegrates slowly, surrounded by a nest of tiny hooks that are embedded in the bait.[3] The entire apparatus is suspended below a large bobber. The fish feed on the small particles that are released from the dough ball and will bump against the dough ball, with the intention of breaking off more small particles that can be filtered from the water, eventually becoming hooked on the tiny hooks.

In some areas, it is also legal to use "snagging gear" in which large, weighted treble hooks are jerked through the water, to snag the fish. In the United States, silver carp are also popular targets for bowfishermen; they are shot both in the water and in the air. In the latter case, boats are used to scare the fish and entice them to jump, and the fish are shot when they jump.

Related species

The genus Hypophthalmichthys has two other species, the bighead carp (H. nobilis) and the largescale silver carp (H. harmandi). The genus Aristichthys is also sometimes used for bighead carp, but this genus was based on fallacious theory and should no longer be used.[4] The bighead carp differs from the silver carp in its behavior (it does not leap from the water when startled) and also in its diet. Bighead carp are also filter feeders, but they filter larger particles than silver carp and in general consume a greater proportion of zooplankton in the diet than silver carp, which consume more phytoplankton. In at least some parts of the United States, bighead and silver carp hybridize in the wild and produce fertile offspring.

The largescale silver carp is very closely related to the silver carp, but its native range is to the south of that of the silver carp, mostly within the country of Vietnam. Unlike bighead and silver carp, largescale silver carp have not been widely introduced around the world for use in aquaculture, although there was at least one introduction to some waters of the Soviet Union, where they hybridized with the also introduced silver carp.

In North America

Silver carp were imported to North America in the 1970s to control algae growth in aquaculture and municipal wastewater treatment facilities. They escaped from captivity soon after their importation.[5] They are considered a highly invasive species.[6] Silver carp, with the closely related bighead carp, often reach extremely high population densities, and are thought to have undesirable effects on the environment and native species.[7]

By 2003, silver carp had spread into the Mississippi, Illinois, Ohio, and Missouri rivers and many of their tributaries in the United States. They are now (August 2009) abundant in the Mississippi River watershed from Louisiana to South Dakota and Illinois, and are close to invading the Great Lakes via the Chicago Sanitary and Ship Canal.[8] Navigation dams on the Mississippi River seem to have slowed their advance up the Mississippi River, and until late November 2008, silver carp had not been captured north of central Iowa on the Mississippi.[9] Dams that do not have navigation locks are complete barriers to upstream natural movement of silver carp, and it is important that fishermen do not assist this movement by the unintentional use of silver carp as bait.[10]

The silver carp is also called the flying carp for its tendency to leap from the water when startled.[11] They can grow to over 40 lb (18 kg), and can leap 10 ft (3 m) in the air. Many boaters traveling in uncovered high-speed watercraft have been injured by running into the fish while at speed. In 2003, a woman jet-skiing broke her nose and a vertebra colliding with a silver carp and nearly drowned.[12] In another example, a leaping silver carp broke the jaw of a teenager being pulled on an inner tube.[13] Water skiing in areas where silver carp are present is extremely dangerous.[14]

References

  1. ^ Kolar et al. 2005. Asian Carps of the Genus Hypophthalmichthys (Pisces, Cyprinidae) ― A Biological Synopsis and Environmental Risk Assessment
  2. ^ Kolar et al. 2007. Bigheaded Carps: Biological Synopsis and Environmental Risk Assessment. American Fisheries Society, Bethesda, MD.
  3. ^ Kolar et al. 2007. Bigheaded Carps: Biological Synopsis and Environmental Risk Assessment. American Fisheries Society, Bethesda, MD.
  4. ^ ACBSRA Final Report 2005
  5. ^ USGS NAS silver carp fact sheet
  6. ^ Conover et al. 2007 Management and Control Plan for Bighead, Black, Grass, and Silver Carps in the United States. Aquatic Nuisance Species Task Force, Washington, D.C. 223 pp. http://www.anstaskforce.gov/Documents/Carps_Management_Plan.pdf
  7. ^ Irons et al. 2007. Reduced condition factor of two native fish species coincident with invasion of non-native Asian carps in the Illinois River, U.S.A. Is this evidence for competition and reduced fitness? Journal of Fish Biology 71:258-273
  8. ^ http://www.edmontonjournal.com/technology/Eating+machine+carp+verge+invading+Great+Lakes/1943527/story.html
  9. ^ http://www.jsonline.com/news/wisconsin/35410349.html
  10. ^ USGS CERC bighead and silver carp fact sheet
  11. ^ Moritz, R. 2008. Pesky 'flying' carp causing problems in SE Arkansas. http://www.arkansasnews.com/archive/2008/09/07/News/347862.html
  12. ^ Maclean's Apr. 17 2006 pg. 39
  13. ^ Moritz, R. 2008. Pesky 'flying' carp causing problems in SE Arkansas. http://www.arkansasnews.com/archive/2008/09/07/News/347862.html
  14. ^ Courier-Journal (Louisville, Kentucky) 2004. Great Flying Carp! Fish A Threat To Boaters, Skiers. http://web.archive.org/web/20050209100948/http://www.flmnh.ufl.edu/fish/InNews/flyingcarp2004.htm
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!