Overview

Comprehensive Description

Biology

Individuals 3.5 cm may ascend rivers, presumably returning to the sea shortly after (Ref. 27547). Presumably young move offshore and reappear inshore as mature adults (Ref. 27547). At sea, they feed on small crustaceans, worms and jellyfish, as well as larval fishes (Ref. 6885, 10276). Females reach age 3, males age 2 (Ref. 27547). Oviparous, with demersal eggs and planktonic larvae (Ref. 35792). Eggs are laid on beaches with heavy surf action (Ref. 33312).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common names: Surf Smelt, Silver Smelt, Day Smelt

Hypomesus Pretiosus (Girard, 1845)

These smelt have a small elongate body without a prominent head, and a gape that ends at the midpoint of eye (2). There are around 70 scales that cover the lateral line, which is incomplete, and all scales are of the cycloid type (9,10). They have numerous even, small, pointed teeth that form a convex series around the entire head of bone; the maxillia is included in the gape, and most jaw bones possess teeth, including the maxilla and pre-maxilla (7,10). Surf Smelts are voracious pelagic carnivores, consuming planktonic organisms (2,8). The axillary process on the base of the pelvic fin is absent. The axillary process is a scale that has been modified and lengthened to a point on the anterior base of the pelvic fin (17). They also have one dorsal fin with 9-11 soft rays and one anal fin with 12-17 soft rays (4). The group's sexual dimorphism in males includes nuptial tubercles on the side, head and fins, females have no tubercules, and a long silver streak running lengthwise along the body (9). Nuptial tubercles are breeding tubercle, which are usually small, raised, epidermal structures on regions of the head, body, or fin rays (4). As a group they have a strange cucumber odor caused by a specific chemical with an unknown function. Surf smelts seeks out gravely beaches, specifically those with a mixture of coarse sand and pea gravel, and swim the in the water column (7,8).

Color: Variant by sex: Males have brownish back and slightly golden underbellies, Females have bluish green backs and silver underbellies (10).

Maximum Length: 30 cm (4).

Average Length: 15 cm ( 4).

Surf Smelt live in shallow coastal regions, are benthopelagic and prefer brackish or marine environments. They live in areas with temperate water (4,10).

Their habitat ranges from Prince William Sound in the Gulf of Alaska to Long Beach, southern California, USA (4).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Individuals 3.5 cm may ascend rivers, presumably returning to the sea shortly after (Ref. 27547). Presumably young move offshore and reappear inshore as mature adults (Ref. 27547). At sea, they feed on small crustaceans, worms and jellyfish, as well as larval fishes (Ref. 6885, 10276). Females reach age 3, males age 2 (Ref. 27547). Oviparous, with demersal eggs and planktonic larvae (Ref. 35792). Eggs are laid on beaches with heavy surf action (Ref. 33312) (4).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: North American form ranges from Long Beach, California (rare south of San Francisco), north to Olsen Bay, Prince William Sound, Alaska. Asian form ranges from Wonsan, Korea, to Petropavlovsk, Kamchatka, and Udskaya Gulf, Sea of Okhosk, (former) USSR (Lee et al. 1980); Korea to Alaska, according to Eschmeyer and Herald (1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: Prince William Sound, Gulf of Alaska to Long Beach, southern California, USA. Reports from the western Pacific are misidentifications of Hypomesus japonicus.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Surf smelt are found from Long Beach, California to Chignik Lagoon, Alaska. They occur throughout the marine waters of Washington, from the Columbia River to the Canadian border and southernmost Puget Sound (14).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 9 - 11; Analspines: 0; Analsoft rays: 12 - 17; Vertebrae: 64 - 67
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The surf smelt has a typical smelt body, with a midline dorsal fin and anal fin directly beneath it and an adipose fin behind (3).

The fin array is as follows: dorsal spines (total): 0; dorsal soft rays (total): 9-11; anal spines: 0; anal soft rays: 12 - 17 (4).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 31 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

30.5 cm TL (male/unsexed; (Ref. 6885)); max. reported age: 5 years (Ref. 72502)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Vomer small, without posterior process; periphery of glossohyal bone with single row of blunt teeth, a few teeth located irregularly at center of distal region; base of adipose fin less than 20% of head length; eye small; adipose eyelid well developed (Ref. 33312). Distinguished by its midlateral scale count of 66 to 73 and the presence of 4 to 7 pyloric caeca (Ref. 27547). Lateral line short and incomplete, reaching about to tip of pectorals (Ref. 27547). Adipose sickle-shaped; pectorals small; pelvic fins originating behind or below dorsal origin (Ref. 6885). Light olive green to brownish on back, sides and belly silvery and iridescent with a bright reflecting band along the side in living specimens; males show more golden hues than females during spawning season (Ref. 6885). Branchiostegal rays: 7-8 (Ref. 35792).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Suft smelt have a silver sidestripe and belly with light olive to brownish on back, a small mouth with an upper jaw that ends before the midline of eye, a pelvic fin begins under the front of the dorsal fin, and small even teeth. Males are more golden than the females (1).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Comments: Marine, sometimes in brackish water, rarely in fresh water (Sandy River, Oregon); in midwaters in deep scattering layer (Lee et al. 1980). Spawns on sand and gravel beaches in light to moderate surf, during incoming or high tide.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 11 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 174.5

Graphical representation

Depth range (m): 0 - 174.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Surf smelt are benthopelagic, and prefer inshore marine or brackish waters (5,11). They will occasionally swim up freshwater rivers and streams, but that is fairly unusual (4). Surf smelt live in 7 - 11 feet off the shore in waters between about 45 - 65 degrees fahrenheit (12, 14). They live coasts with coarse sand and pea gravel (13). Vegetative shading is preferable to keep the waters and sediments cool, need specifically to keep eggs cool during maturation (15). The movements of juveniles and adults between spawning seasons is virtually unknown (14).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Surf smelts migrate high up onto the beach during spawning in order to reduce predation. (16) Individuals 3.5 cm may ascend rivers, presumably returning to the sea shortly after (Ref. 27547). Presumably young move offshore and reappear inshore as mature adults (Ref. 27547). (4)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats crustaceans, copepods, amphipods, crabs, larvae, euphausiids, etc.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Individuals 3.5 cm may ascend rivers, presumably returning to the sea shortly after (Ref. 27547). Presumably young move offshore and reappear inshore as mature adults (Ref. 27547). At sea, they feed on small crustaceans, worms and jellyfish, as well as larval fishes (Ref. 6885, 10276). Feeds on fish, benthic animals and zooplankton (Ref. 6885).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

At sea, they feed on small crustaceans, worms and jellyfish, as well as larval fishes (Ref. 6885, 10276), but they have also been known to eat plankton including copepods, amphipods, krill, euphasids, cladocerans (4,5).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Preyed upon by chinook salmon.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

The surf smelt school with the same sex (5). They normally stay in the marine zones during their entire life, though the young are raised in brackish waters and fish of 3.5 cm or smaller do occasionally go up streams only to return quickly. The young live offshore and come inshore soon after they have matured (4).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Schools approach the beach to spawn, usually with the females appearing a few days before the males. At spawning, large numbers of males mill about near the edge of the surf. When a female is seen, numbers of males pursue her and try to get into spawning position. If she swims to deeper water, the males desert her. 1 to 5 males swim parallel to and slightly behind a ripe female. The males press against the female and as they reach water 2.5 to 5 cm deep, the fish bend and vibrate, releasing eggs and sperm, then retreat to deeper water. The spawning act may be repeated on several successive waves. Wave action buries the eggs, usually to a depth of 2.5 to10 cm but sometimes to as deep as 30 cm (Ref. 27547).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Surf smet are oviparous with between 1,300–37,000 eggs released during mating (6). Maturation occurs between 8 and 28 days, though can last for as long as 56 days in cases of extreme cold(15). Larva are 3 mm in length at birth. The male to female ratio is 1:1(5). During spawning, several males surround a ripe female all vibrating in unison with the eventual release of both eggs and sperm into the water, where the fertilized eggs eventually drift to the bottom and are covered in sand. This spawning occurs in tide pools all year long(4).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Spawns in daylight during most of the year. Female lays 1,320-29,950 adhesive eggs. Eggs may hatch in 10-11 days, or more in fall and winter (Lee et al. 1980). Apparently females spawn more than once in a season (Morrow 1980). Lives maximum of 2-3 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Smelt are oviparous reaching sexual maturity during their second year (4,5). Once fertilized the outer membrane of the egg breaks and turns inside out, gathering at the bottom and dragging the egg to the sand, which over time covers them (5). Development rates of surf smelt eggs vary greatly with seasonal ambient temperature. Surf smelt eggs maturing in winter months require between 27 and 56 days to hatch, while those maturing in summer months required between 11 and 16 days. Regardless of the brooding time, surf smelt eggs release larva measuring about 3 mm, which are at the mercy of the local tides and currents. After about 3 months,they have grown to about 30 mm and taken on their adult form and coloration. Mating takes place all year. The maximum life span of a surf smelt is thought to be 5 years, though generally 2 for males and3 for females (4, 5, 12).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Growth

Surf Smelt reach a maximum length 30.5 cm (TL male/unsexed) (Ref. 6885); but generally reach only 15.0 cm (TL male/unsexed)(Ref. 12193); and have a maximum reported age of 5 years (Ref. 72502) (4).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hypomesus pretiosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTGGCACCCTCTATCTGATCTTCGGGGCCTGGGCAGGAATAGTAGGGACGGCTTTAAGCCTCCTTATCCGAGCCGAGCTTAGCCAACCTGGCGCTCTTCTGGGGGACGACCAGATTTATAATGTTATCGTCACTGCACACGCTTTTGTTATAATCTTTTTTATGGTTATACCAATTATGATTGGAGGGTTTGGTAACTGGCTTATCCCCCTTATGATCGGGGCCCCAGACATGGCATTCCCCCGTATGAACAACATGAGCTTCTGACTCCTCCCTCCCTCTTTCCTTCTTCTTTTGGCCTCCTCCGGGGTCGAAGCAGGGGCCGGAACTGGTTGAACAGTTTACCCTCCGCTTGCGGGGAATCTCGCCCATGCGGGAGCTTCCGTAGATTTGACCATTTTTTCTCTCCATCTTGCAGGAATCTCCTCTATTTTAGGGGCAATTAACTTTATCACAACTATTATTAACATGAAACCCCCTGCCATTTCCCAGTACCAGACTCCTTTATTCGTTTGGGCCGTTCTAATTACAGCTGTCCTTCTTCTTCTTTCCCTTCCAGTGCTAGCTGCTGGGATTACTATGCTTCTCACAGACCGAAACCTCAACACCACCTTCTTTGACCCTGCCGGGGGAGGGGACCCCATTCTGTACCAGCATCTATTCTGATTCTTCGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hypomesus pretiosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Status (Ref. 57073): Not Evaluated (4).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Resilience (Ref. 69278) Medium, minimum population doubling time 1.4 - 4.4 years (4).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vulnerability (Ref. 59153): Low to moderate vulnerability (4).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Harvested when spawning on beaches; also caught commercially (Eschmeyer and Herald 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Surf Smelt are highly valuable as food: about 100,000 tons are caught commercially per year. They are also a sport fish, with a season between July and January and are used for both consumption and bait for larger fishes (19).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Hypomesus pretiosus

Hypomesus pretiosus, or surf smelt, is a marine smelt with a range from Prince William Sound, Alaska to Long Beach, California, although its population declines south of San Francisco. The surf smelt grows to be about 10 inches in southern waters, and 834 inches in northern waters near Canada. On average, surf smelt weigh about 10 to the pound.[1]

Spawning occurs in the daytime, which is why it is sometimes called the day smelt,[2] peaking in the months from May to October. With a maximum age of three to four years, some females will spawn at the age of one, and all will spawn at the age of two. Females lay from 1,500-30,000 sticky eggs in the surf zone per spawn, which they may do three to five or more times in a season.[1]

H. pretiosus feed on polychaete worms, larval fish and jellyfish, but they primarily feed on small crustaceans. They can be important parts of salmon and halibut diets, and are the most economically important fish among California smelts. Around 225,000 kilograms are harvested there every year.[1][3]

References[edit]

  1. ^ a b c Fitch JE, Lavenberg RJ. Tidepool and nearshore fishes of California. University of California Press; 1975. ISBN 978-0-520-02845-6. p. 92.
  2. ^ Eschmeyer WN, Peterson RT, Herald ES. A field guide to Pacific coast fishes: North America. Houghton Mifflin Harcourt; 1999. ISBN 978-0-618-00212-2. p. 80.
  3. ^ Moyle PB. Inland fishes of California. 2nd ed. California: University of California Press; 2002. ISBN 978-0-520-22754-5. p. 226.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Originally two subspecies were recognized by McAllister (1963): H. P. PRETIOSUS of North America and H. P. JAPONICUS of coastal Asia. These subspecies were raised to species status by Klyukanov (1975) (Lee et al. 1980). Eschmeyer and Herald (1983) retained JAPONICUS as a subspecies of PRETIOSA. See Begle (1991) for a classification and phylogeny of osmeroid fishes based on morphology.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!