Overview

Comprehensive Description

Biology

A little-known shark (Ref. 9997) found on the continental shelf from close inshore to a depth of at least 110 m (Ref. 6871). Feeds mainly on fishes, but also takes cephalopods and crustaceans (Ref. 6871). Viviparous (Ref. 50449). Caught frequently by inshore demersal gillnet fisheries off Papua, but rarely elsewhere. Utilized for its fins and meat (Ref.58048). Too small to be of any commercial importance (Ref. 6871).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Papua New Guinea and Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Pacific: off Papua New Guinea and northern Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This is an abundant inshore species that occurs across in northern Australia and in southern Papua New Guinea (Last and Stevens 1994).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 670 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

69.1 cm TL (male/unsexed; (Ref. 9161)); max. reported age: 7 years (Ref. 9161)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Brownish grey above, white below, fins light-edged but not conspicuously marked (Ref. 9997).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth: 0 - 110m.
Recorded at 110 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

pelagic-oceanic; marine; depth range ? - 300 m (Ref. 75154)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is abundant in inshore waters, especially over soft-bottomed habitats. The diet includes mostly teleost fishes, but also crustaceans and cephalopods (Simpfendorfer 1998). The young are born at 25 cm, males and females mature at approximately 55 cm, and they reach a maximum size of 67 cm (Last and Stevens 1994). This species has one of the most r-selected life histories of any shark species. Simpfendorfer (1992) reported that mature females produce litters of 1 to 10 young every year after a gestation period of 11.5 months. Interestingly, this is the only species of shark in which a period of embryonic diapause occurs (7.5 months) during which embryonic development is arrested. R. taylori is a rapidly growing species, reaching maturity after only one year, and living to a maximum of seven years (Simpfendorfer 1993). Estimates of natural mortality rates using catch curve analysis are 0.56 per year for females and 0.70 per year for males (Simpfendorfer 1999). Estimates of the intrinsic rate of population increase are 0.27 which give a population doubling time of 2.55 years. This rate of population increase is amongst the highest for any species of elasmobranch, and means that they are able to sustain relatively high levels of fishing pressure. If all age classes are fished equally the population can withstand an instantaneous fishing mortality rate of 0.18, and if the immature animals are not fished then this increases to 0.67.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 37 specimens in 1 taxon.
Water temperature and chemistry ranges based on 14 samples.

Environmental ranges
  Depth range (m): 4 - 78
  Temperature range (°C): 25.344 - 28.013
  Nitrate (umol/L): 0.164 - 3.117
  Salinity (PPS): 34.492 - 35.156
  Oxygen (ml/l): 2.877 - 4.701
  Phosphate (umol/l): 0.120 - 0.657
  Silicate (umol/l): 0.869 - 12.679

Graphical representation

Depth range (m): 4 - 78

Temperature range (°C): 25.344 - 28.013

Nitrate (umol/L): 0.164 - 3.117

Salinity (PPS): 34.492 - 35.156

Oxygen (ml/l): 2.877 - 4.701

Phosphate (umol/l): 0.120 - 0.657

Silicate (umol/l): 0.869 - 12.679
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs on the continental shelf and slope (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Viviparous, with a yolk-sac placenta (Ref. 9997) and 1-10 pups after a gestation period of 11-12 months; born at ~ 25 cm TL; very rapid growth (Ref.58048). Distinct pairing with embrace (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 7 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhizoprionodon taylori

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAATTTTTGGTGCATGGGCAGGTATAGTTGGAACAGCCCTAAGTCTCCTAATTCGAGCCGAACTTGGTCAACCTGGATCTCTTTTAGGAGACGATCAGATTTATAATGTGATCGTAACTGCCCACGCTTTTGTAATAATCTTTTTTATGGTTATACCAGTTATAATTGGTGGCTTCGGAAATTGACTGGTCCCTCTAATAATTGGTGCACCAGATATAGCCTTCCCACGAATAAATAACATAAGCTTCTGACTCCTCCCACCATCATTCCTTCTTCTCCTAGCTTCTGCTGGGGTAGAAGCTGGAGCAGGTACTGGTTGAACAGTTTATCCTCCATTAGCTAGCAATCTAGCTCATGCCGGACCATCTGTTGACCTGGCTATTTTCTCCCTCCATTTGGCCGGTGTTTCATCAATTTTAGCCTCAATTAACTTTATTACAACTATCATTAATATAAAACCACCAGCTATCTCCCAATATCAAACACCTTTATTTGTTTGATCTATTCTTGTAACTACTATTCTCCTCCTCCTTTCACTTCCAGTCCTTGCAGCAGGGATTACAATATTACTTACAGACCGTAACCTTAATACCACATTCTTTGATCCTGCGGGTGGGGGAGATCCAATTCTTTACCAACATCTANNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Rhizoprionodon taylori

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2003

Assessor/s
Simpfendorfer, C.A. (SSG Australia & Oceania Regional Workshop, March 2003)

Reviewer/s
Fowler, S. & Cavanagh, R.D. (Shark Red List Authority)

Contributor/s

Justification
Rhizoprionodon taylori is a small abundant inshore shark restricted to southern Papua New Guinea and northern Australia where it is caught as bycatch in inshore gillnet and trawl fisheries. Catches at times are large, but sporadic. It is not a targeted species and is one of the most productive species of shark known, growing very rapidly, maturing after one year with females producing up to 10 pups every year. This life history makes them able to sustain considerable fishing pressure, especially when the immature animals are not exploited.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There are no data available on the population size, but the demographics of the population has been investigated by Simpfendorfer (1999).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
This species of taken as bycatch in inshore gillnet fisheries for mackerel and barramundi along the Queensland coast. At times large catches are made, but these events are sporadic and the overall catch is relatively small. In the waters off the Northern Territory this species makes up about 0.5% of the catch in gillnet and longline fisheries (Stevens 1999), but its size is considered to be too small for retention (Last and Stevens 1994). Many of the animals discarded in these fisheries are already dead.

Despite the level of fishing on this species its life history makes it relatively resilient to the moderate levels of fishing pressure to which it is subjected.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The fisheries in which R. taylori is caught in northern Australia are regulated by either the relevant state government, or the federal government. However, there are no specific regulations that apply to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Australian sharpnose shark

The Australian sharpnose shark, Rhizoprionodon taylori, is a requiem shark of the family Carcharhinidae, found in the tropical waters of the western Pacific Ocean off Papua New Guinea and northern Australia between latitudes 8° N and 28° S, from the surface to 110 m. Its length is up to about 70 cm.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!