Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

A secretive species occurring on coral reefs where it hides among soft corals and benthic algae. Feeds on benthic invertebrates. Monogamous (Ref. 52884). Rarely found in the aquarium trade.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The species is found from the Red Sea to the east Andaman Sea, and eastwards to Tonga, north to Japan and south to Lord Howe Island (east Australia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: Red Sea; then from Indonesia to Samoa, north to the Philippines and Micronesia, south to the Great Barrier Reef.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea endemic; Western Pacific populations belong to a separate, undescribed species [Indonesia east to Samoa, north to Philippines and Micronesia, south to Great Barrier Reef (Queensland, Australia) and New Caledonia].
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10; Dorsal soft rays (total): 10; Analspines: 3; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 95 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

9.5 cm TL (male/unsexed; (Ref. 2334))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Has 10 dorsal spines, lacks distinct vertical barring or longitudinal lines, and has yellow or reddish edged ocellus on the gill cover. First 3 dorsal fin spines elongated in adults (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Pteragogus cryptus Randall
Catalog Number: USNM 223872
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Springer, G. Raz & L. Hughes-Gannes
Year Collected: 1969
Locality: Israel (sic), Gulf of Aqaba, Bay at El Himeira., Egypt, Gulf of Aqaba, Red Sea, Indian
Depth (m): 9 to 12
  • Paratype: Randall, J. E. 1981. Senckenbergiana Maritima. 13 (1/3): 83.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pteragogus cryptus Randall
Catalog Number: USNM 223874
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): H. Fehlmann & et al.
Year Collected: 1965
Locality: U.A.R.: Red Sea, Strait of Jubal, SE edge of Sha'b Abu Qualawa reef ca. 3 miles north of Institute of Oceanography and Fisheries, Ghardaqa, Egypt, Strait of Jubal, Red Sea, Indian
Depth (m): 5
Vessel: Anton Bruun
  • Paratype: Randall, J. E. 1981. Senckenbergiana Maritima. 13 (1/3): 83.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pteragogus cryptus Randall
Catalog Number: USNM 223877
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): W. Smith-Vaniz
Year Collected: 1977
Locality: Red Sea, Reef On N. Side of Jeddah Harbor, Saudi Arabia, Red Sea, Indian
Depth (m): 15 to 18
  • Paratype: Randall, J. E. 1981. Senckenbergiana Maritima. 13 (1/3): 83.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pteragogus cryptus Randall
Catalog Number: USNM 222297
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Randall & P. Vine
Year Collected: 1974
Locality: Red Sea, Sudan, Suakin Harbor, Off Marine Lab Jetty, Sudan, Red Sea, Indian
Depth (m): 3 to 6
  • Paratype: Randall, J. E. 1981. Senckenbergiana Maritima. 13 (1/3): 83.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pteragogus cryptus Randall
Catalog Number: USNM 223869
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Springer et al.
Year Collected: 1969
Locality: Israel, Gulf of Aqaba, Bay at El Himeira, Egypt, Gulf of Aqaba, Red Sea, Indian
Depth (m): 21 to 27
  • Paratype: Randall, J. E. 1981. Senckenbergiana Maritima. 13 (1/3): 83.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is secretive and cryptic occurring on coral reefs where it hides among soft corals and benthic algae (Whiteman and Côté 2004). It inhabits lagoon and seaward reefs at depths 4-67 m (Myers 1999). It likes rich soft or hard coral growth or scattered algae and stays well hidden.

This species is a pair spawner (Donaldson 1995). At spawning both male and female assume a dark brown colour pattern without the normal white markings. It is monogamous. It feeds on benthic invertebrates (Whiteman and Côté 2004).

The largest recorded size was 9.5 cm TL (Randall et al. 1990). Mature females were recorded at 36 mm and males at 45 mm.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 2 - 67 m (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 25 specimens in 1 taxon.
Water temperature and chemistry ranges based on 15 samples.

Environmental ranges
  Depth range (m): 1.525 - 39.5
  Temperature range (°C): 27.617 - 29.205
  Nitrate (umol/L): 0.053 - 1.118
  Salinity (PPS): 32.276 - 34.582
  Oxygen (ml/l): 4.130 - 4.641
  Phosphate (umol/l): 0.071 - 0.380
  Silicate (umol/l): 0.722 - 6.058

Graphical representation

Depth range (m): 1.525 - 39.5

Temperature range (°C): 27.617 - 29.205

Nitrate (umol/L): 0.053 - 1.118

Salinity (PPS): 32.276 - 34.582

Oxygen (ml/l): 4.130 - 4.641

Phosphate (umol/l): 0.071 - 0.380

Silicate (umol/l): 0.722 - 6.058
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 2 - 67m.
From 2 to 67 meters.

Habitat: reef-associated. A secretive species occurring on coral reefs where it hides among soft corals and benthic algae. Feeds on benthic invertebrates. Rarely found in the aquarium trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

A secretive species occurring on coral reefs where it hides among soft corals and benthic algae. Feeds on benthic invertebrates.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pteragogus cryptus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTATACCTCGTTTTCGGTGCTTGAGCCGGAATAGTCGGCACGGCCTTGAGCCTGCTGATCCGGGCTGAACTAAGCCAACCAGGGGCTCTTCTAGGCGATGACCAGATTTATAACGTAATTGTTACTGCTCATGCATTCGTAATGATTTTCTTTATAGTCATGCCTATCATGATTGGAGGGTTTGGAAACTGGCTTATCCCTTTAATGATCGGAGCCCCCGATATGGCCTTCCCACGAATAAATAATATGAGTTTTTGACTACTGCCCCCTTCATTCCTCCTTCTACTTGCCTCCTCAGGGGTAGAAGCTGGAGCTGGTACCGGATGAACTGTATATCCTCCCCTCGCAGGGAACCTGGCCCATGCAGGAGCCTCCGTAGACTTAACCATCTTCTCACTACATTTAGCCGGAATTTCATCAATTCTTGGTGCAATCAATTTTATTACGACAATTATCAACATGAAGCCCCCAGCAATTTCCCAATATCAGACACCTTTATTTGTGTGGGCTGTCCTTATTACAGCCGTTCTCCTACTCCTCTCACTTCCAGTCCTTGCTGCTGGTATTACAATGCTTCTTACAGATCGAAACCTCAACACAACCTTCTTTGACCCGGCAGGAGGCGGAGACCCAATTCTTTACCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pteragogus cryptus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Sadovy, Y.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This species is wide-ranging and there are no known major threats. It is a small and cryptic species and is found in a number of marine protected areas in parts of its range. It is therefore listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species was recorded in the east coast of Peninsular Malaysia, with a mean density of 1.6 individuals from twenty 50 m X 5 m transects in underwater fish visual surveys (Yusuf et al. 2002).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!