Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occurs in shallow lagoon and seaward reefs, slopes and along drop-offs to moderate depths. Occurs in small, loose groups (Ref. 48636). Feeds on benthic and planktonic crustaceans, small fishes, and foraminiferans.
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is widespread in the Indo-Pacific Ocean, and occurs from east Africa to the Line and Tuamoto Islands and from Japan to Lord Howe and Austral Islands (Myers 1991), including Thailand, Taiwan, Pratas and Spratley Islands (Sadovy and Cornish 2000).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: East Africa to the Line and Tuamoto islands, north to southern Japan, south to the Lord Howe and Austral islands.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: South Africa, East Africa, Seychelles, Madagascar and Mascarenes east to Wake Atoll and Tuamotu Archipelago, north to southern Japan and Ogasawara Islands, south to Lord Howe Island, New Caledonia, Tonga and Austral Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8; Dorsal soft rays (total): 12 - 14; Analspines: 3; Analsoft rays: 11
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 180 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

20.0 cm TL (male/unsexed; (Ref. 48636))
  • Kuiter, R.H. and T. Tonozuka 2001 Pictorial guide to Indonesian reef fishes. Part 2. Fusiliers - Dragonets, Caesionidae - Callionymidae. Zoonetics, Australia. 304-622 p. (Ref. 48636)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Color pattern remains similar with growth with terminal males becoming gaudier than primary males (Ref. 37816). Pale green with 6 dark bars, last two as saddles over the tail. Head with pink bands radiating from eye in large adults (Ref. 48636).
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species inhabits coral reefs (Allen 2000), shallow lagoon and seaward reefs, slopes and along drop-offs to depths of one to 15 m (Myers 1991, Kuiter and Tonozuka 2001), but may be found deeper.

Bodies of terminal phase individuals have six vertical black bars which are progressively shorter posteriorly, the first black bar passing beneath pectoral fins to abdomen, whilst the last bar is a saddle-liked spot on caudal peduncle (Westneat 2001) and broad pink bands radiating from eye (Sadovy and Cornish 2000, Kuiter 2006). Males and females differ slightly in colour although males are gaudier (Myers 1991). Initial phase is light green in colour with six wedge-shaped, slightly diagonal, dark bars dorsally on body (Sadovy and Cornish 2000).

Adults are diurnally active foraging over large (> 1000 m2) home ranges (Shima 1999a). It feeds on a variety of preys including fish eggs (eggs of Stegastes ngricans) (Shima and Osenberg 2003), benthic and planktonic crustaceans, small fishes, foraminiferans (Sano et al. 1984) and fish larvae (Dascyllus flavicausus) (Holbrook et al. 2003)

The mean duration of the planktonic larval stage was approximately 47 +/-8 days and the maximum recorded duration was 63 days (Victor 1986). It was found to settle on live coral habitat during the early benthic life history (Shima 1999) and settlement occurred during discrete lunar periods (Shima and Osenberg 2003). In Moorea Island, French Polynesia, Dufour et al. (1996) found that settlement occurred over five consecutive nights surrounding new moons between January and June. It was observed to settle at 35 mm in length (1999). It settles directly to patch reefs composed of live coral habitats or algal turf and newly settled individuals remain relatively inactive in algal turf or within branching corals for one to three days while developing juvenile pigmentation patterns (Shima 2001). In addition, juveniles remain site-attached for approximately four to six months (Shima 1999a).

Shima (1999, 2001, 2001a) demonstrated that density dependent mortality occurred shortly after settlement to coral communities. And strength of the density dependence mortality was found to be heterogeneous in space and time and was correlated with coral community attributes (Shima 1999, 2001, Shima and Osenberg 2003, Shima et al. 2005).

It has been reported to be diandric in Japan (Sadovy and Cornish 2000). During courtship, the terminal phase males had a dark spot on the center of the caudal fin which was absent on the initial phase females. The female ascent rapidly about three to four m when ready to spawn and the terminal phase male swam above her, rapidly fluttering pectoral and caudal fins. Spawning activities were observed in the morning after high tide in May at Marshall Islands (Colin and Bell 1991).

Aggregation spawning was documented at Heron Island (Robertson and Choat 1974) and waters adjacent to the Great Barrier Reef Marine Park (Russell 2001). However, such behaviour has rarely been study.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 0 - 15 m (Ref. 2334), usually 0 - 15 m (Ref. 27115)
  • Baensch, H.A. and H. Debelius 1997 Meerwasser atlas. Mergus Verlag GmbH, Postfach 86, 49302, Melle, Germany. 1216 p. 3rd edition. (Ref. 27115)
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 206 specimens in 1 taxon.
Water temperature and chemistry ranges based on 155 samples.

Environmental ranges
  Depth range (m): 0.15 - 33
  Temperature range (°C): 24.633 - 29.336
  Nitrate (umol/L): 0.019 - 1.204
  Salinity (PPS): 32.019 - 36.148
  Oxygen (ml/l): 4.202 - 4.851
  Phosphate (umol/l): 0.055 - 0.415
  Silicate (umol/l): 0.897 - 5.552

Graphical representation

Depth range (m): 0.15 - 33

Temperature range (°C): 24.633 - 29.336

Nitrate (umol/L): 0.019 - 1.204

Salinity (PPS): 32.019 - 36.148

Oxygen (ml/l): 4.202 - 4.851

Phosphate (umol/l): 0.055 - 0.415

Silicate (umol/l): 0.897 - 5.552
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 15m.
Recorded at 15 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154).
  • Sano, M., M. Shimizu and Y. Nose 1984 Food habits of teleostean reef fishes in Okinawa Island, southern Japan. University of Tokyo Bulletin, no. 25. v,128p. University of Tokyo Press, Tokyo, Japan. 128 p. (Ref. 6110)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thalassoma hardwicke

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 33 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CATAAAGATATTGGCACCCTCTATCTTGTGTTCGGCGCATGAGCCGGAATAGTGGGTACAGCCCTGAGCCTGCKCATTCGAGCAGAGCTAAGCCAGCCCGGCGCCCTCCTTGGGGAC---GATCAGATCTATAACGTCATCGTTACAGCCCATGCATTTGTCATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTCGGAAACTGACTTATTCCCCTAATGATTGGGGCCCCTGACATGGCCTTCCCTCGGATGAACAACATAAGCTTTTGACTCCTTCCCCCTTCATTCCTTCTCCTCCTTGCCTCTTCTGGCGTTGAAGCGGGAGCCGGAACCGGATGAACGGTTTACCCGCCTTTAGCAGGTAATCTTGCCCACGCTGGCGCATCCGTTGACCTTACTATTTTTTCATTACACCTAGCGGGTATCTCCTCAATCCTCGGTGCAATTAACTTCATTACAACCATTATTAATATGAAGCCCCCAGCGATCTCACAATACCAAACGCCTCTTTTCGTGTGAGCCGTTCTAATTACAGCAGTCCTTCTTCTCCTCTCCCTTCCGGTTCTGGCTGCTGGAATTACAATGCTCCTAACGGACCGAAATCTAAACACCACCTTCTTTGACCCTGCTGGAGGAGGGGACCCAATTCTTTACCAACATCTATTCTGATTTTTTGGTCAC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Thalassoma hardwicke

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 27
Specimens with Barcodes: 51
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 3 specimens with morphological vouchers housed at British Antarctic Survey
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Shea, S., Liu, M. & Sadovy, Y.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This species is widespread in the Indo-Pacific, and is common in many parts of its range. It is collected for the aquarium trade and closely associated with several hard coral species and coral reef habitat is in decline in parts of its range. However, there are no known major threats to this species. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is common in many parts of its range.

It is the most common labrid on Moorea, French Polynesia (Galzin 1987). A total of 6,090 individuals were counted in various UVC surveys with body sizes of 3-20 cm TL (M. Kulbicki pers. comm. 2008).

In Fiji, a total of 803 individuals were counted in various UVC surveys with body sizes of 4-17 cm TL (M. Kulbicki pers. comm. 2008).

In Tonga, a total of 809 individuals were counted in various UVC surveys with body sizes of 5-25cm TL (M. Kulbicki pers. comm. 2008).

In New Caledonia, a total of 3,712 individuals were counted in various UVC surveys with body sizes of 3-23 cm TL. In 9 stations, a total of 20 individuals were caught with total body weight of 417 g(M. Kulbicki pers. comm. 2008).

In Marshall Islands, it occurred on most shallow reefs, but not abundant (Colin and Bell 1991). It is also a common reef fish in Solomon Island (Allen 2006), the Barakau Village and Papua New Guinea (Raga 2006)

It is the one of the top twentieth most common species of piscivorous fish at Lizard Island (14° 40’ S 145° 28’ E), Australia (Stewart and Beukers 2000).

In Kimbe Bay of Papua New Guinea, it was found to be one of the top fifteenth most abundant species with a total abundance of 3231 individuals and a mean density of 1.55 individuals per 100 m2 (Srinivasan and Jones 2006). It is also the dominant fish species in Trou aux Biches and Troud’ Eau Douce, Mauritius (Ministry of Agro Industry and Fisheries and Albion Fisheries Research Centre 2004).

In Micronesia, it is moderately common in clear water areas of mixed coral, rubble and sand, particularly along upper edges of protected reef slopes (Myers 1991).

Large numbers were found in the upper lagoon of the Ashmore Reef National Nature Reserve (Kospartov et al. 2006).

In Hong Kong, it is rare, only one individual was seen in area of coral at 3 m depth (Sadovy and Cornish 2000).

8 individuals were observed in the Maumere, Indonesia through an underwater visual census survey (Kulbicki undated).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known to this species. It is collected for the aquarium trade, but is not heavily targeted. Coral reef loss and habitat destruction may contribute to localized declines in some parts of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific conservation measures in place for this species. Its distribution overlaps several marine protected areas within its range.

While many marine parks have been introduced within the geographic distribution range of this species, for example in Indonesia, Papua New Guinea and Philippines (Tun et al. 2004), most of these marine protected areas (MPAs) are considered to be poorly managed or legislation is poorly enforced due to the lack of expertise, resource and effective co-ordination. For instance, some of the fish sanctuaries in the Philippines are only managed and enforced by the resort management (Tubod fish sanctuary) or local communities (White et al. 2002). As the efficacy of any legislation depends entirely upon its enforcement (Claydon 2004), the majority of these MPAs might not be able to provide sufficient protection (Licuanan and Gomez 2000, Chou et al. 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
  • Edwards, A.J. and A.D. Shepherd 1992 Environmental implications of aquarium-fish collection in the Maldives, with proposals for regulation. Environ. Conserv. 19:61-72. (Ref. 4907)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Thalassoma hardwicke

The sixbar wrasse or six-banded wrasse, Thalassoma hardwicke, is a species of wrasse native to the Indian Ocean and the western Pacific Ocean. It is an inhabitant of reef environments at depths from the surface to 15 m (49 ft). This species can grow to 20 cm (7.9 in) in total length, though most do not exceed 15 cm (5.9 in). It is of minor importance to local commercial fisheries and can also be found in the aquarium trade.[2]

References[edit]

  1. ^ Shea, S., Liu, M. & Sadovy, Y. 2010. Thalassoma hardwicke. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 17 November 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Thalassoma hardwicke" in FishBase. October 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!