Overview

Comprehensive Description

Sphyraena pinguis ZBK Günther , 1874

Aegean Sea : 18200-663 (3 spc.), 13.08.1989 , Goekova Bay , ring net , N. Meriç . Mediterranean Sea : 18200-376 (5 spc.), 05.04.1962 , Iskenderun Bay ; 18200-373 (5 spc.), 01.05.1977 , Antalya-Anamur , Nasuh Dagli ; 18200-364 (1 spc.), 01.08.1968 , M. Demir ; 18200-375 (1 spc.), 13.02.1968 , Mersin Bay , trawl , M. Demir ; 18200-374 (1 spc.), 01.08.1968 , M. Demir .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 48-48, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Found near shore on mud, sandy mud or rock bottoms (Ref. 11230, 48637). Usually forms large schools (Ref. 48637). Feeds on fishes.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Northwest Pacific: southern Japan to the East China Sea and northern South China Sea (Ref. 12068).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific from South Africa to Australia; western North Pacific: Japan, Korea and China; introduced into Black Sea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 300 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

50.0 cm TL (male/unsexed; (Ref. 56557))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-neritic; marine; depth range 3 - 6 m (Ref. 48637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits coral reefs (Ref. 58534). Feeds on fishes (Ref. 9137); and small quantities of shrimp and cephalopods (Ref. 55455).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sphyraena pinguis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACTTACTATTTGGTGCCTGAGCAGGGATGGTAGGCACCGCCCTTAGCCTACTCATTCGTGCCGAATTAAGCCAACCTGGCTCTCTCCTAGGGGATGACCAAATCTATAACGTCATCGTCACAGCCCACGCCTTCGTGATAATCTTCTTCATAGTCATGCCCATTATGATTGGAGGCTTCGGTAACTGACTCATCCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCTCGAATGAACAATATAAGCTTCTGACTTCTACCACCCTCATTCCTTCTCCTCCTTGCCTCTTCGGCCGTAGAAGCAGGAGCAGGAACGGGCTGAACTGTTTACCCCCCTTTAGCCGGCAACTTAGCTCACGCAGGGGCATCAGTTGACCTAACCATCTTCTCCCTTCATCTTGCGGGCATCTCCTCTATTCTTGGGGCAATTAACTTTATTACCACCATTATTAATATAAAACCACCATCCACAACCATGTATCAAATCCCACTATTTGTGTGGGCAGTACTAATCACTGCTGTGCTTCTACTGCTTTCTCTGCCTGTGCTGGCTGCGGGGATTACAATACTATTGACAGATCGAAACCTAAACACAGCCTTCTTTGACCCCGCTGGCGGAGGGGACCCCATTCTTTACCAGCATTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sphyraena pinguis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; price category: medium; price reliability: questionable: based on ex-vessel price for species in this genus
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!