Overview

Comprehensive Description

Biology

Found in the vicinity of coral reefs on sand or rubble bottoms.
  • Knapp, L.W. 1984 Platycephalidae. In W. Fischer and G. Bianchi (eds.) FAO species identification sheets for fishery purposes. Western Indian Ocean (Fishing Area 51). Vol. 3. FAO, Rome. pag. var. (Ref. 3476)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Indian Ocean: Red Sea, including the Gulf of Aqaba to South Africa and Madagascar.
  • Knapp, L.W. 1984 Platycephalidae. In W. Fischer and G. Bianchi (eds.) FAO species identification sheets for fishery purposes. Western Indian Ocean (Fishing Area 51). Vol. 3. FAO, Rome. pag. var. (Ref. 3476)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Western Indian Ocean: Gulf of Oman and Gulf of Aden south to northern South Africa, east to Seychelles; Mediterranean Sea immigrant.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 11; Analspines: 0; Analsoft rays: 11
  • Knapp, L.W. 1986 Platycephalidae. p. 482-486. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4315)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 700 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

70.0 cm TL (male/unsexed; (Ref. 4315))
  • Knapp, L.W. 1986 Platycephalidae. p. 482-486. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4315)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Found in the vicinity of coral reefs on sand bottoms.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Body mottled with brownish or greenish above, whitish below; caudal fin with 3-4 dark bands, other fins with large dark blotches (Ref. 4315).
  • Knapp, L.W. 1986 Platycephalidae. p. 482-486. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4315)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 1 - 15 m (Ref. 9710)
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 33 - 33
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 15m.
From 1 to 15 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found in the vicinity of coral reefs on sand or rubble bottoms.
  • Gell, F.R. and M.W. Whittington 2002 Diversity of fishes in seagrass beds in the Quirimba Archipelago, northern Mozambique. Mar. Freshwat. Res. 53:115-121. (Ref. 41878)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Papilloculiceps longiceps

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTTGGTGCCTGAGCCGGAATAGTTGGGACAGCCCTAAGTCTCCTTATCCGAGCAGAACTCAGCCAACCCGGAGCCCTCCTGGGAGACGACCAGATTTACAACGTAATTGTTACAGCCCATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATCGGGGGGTTTGGAAACTGGCTCGTGCCCCTAATGATTGGAGCCCCTGACATAGCATTCCCTCGAATAAATAACATAAGCTTCTGACTACTACCCCCCTCCTTCCTCCTCCTCCTTGCCTCCTCCGCTGTGGAAGCCGGCGCGGGAACTGGGTGAACGGTTTACCCCCCACTAGCAGGGAACTTAGCCCACGCCGGGGCCTCCGTCGACCTAACCATCTTCTCGCTCCACCTGGCGGGAATCTCCTCCATCCTGGGGGCTATCAACTTCATTACAACAATCATTAACATAAAACCCGCCGCAATTACACAATACCAAACACCACTTTTCGTGTGGGCCGTACTAATTACCGCTGTCCTCCTCCTCTTGTCTCTGCCAGTCCTGGCCGCCGGTATCACAATGCTCCTTACAGACCGAAACTTAAACACAACCTTCTTCGACCCTGGCGGAGGAGGAGATCCAATCCTCTACCAACACCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Papilloculiceps longiceps

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries
  • Knapp, L.W. 1984 Platycephalidae. In W. Fischer and G. Bianchi (eds.) FAO species identification sheets for fishery purposes. Western Indian Ocean (Fishing Area 51). Vol. 3. FAO, Rome. pag. var. (Ref. 3476)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Tentacled flathead

The Tentacled flathead (Papilloculiceps longiceps) or Crocodilefish is a member of the order Scorpaeniformes, an order which also includes the scorpionfishes and stonefishes. It is found in the Western Indian Ocean; the Red Sea.

Behaviour[edit]

They are predatory bottom-dwelling fish, using their camouflage to ambush their prey.

Description[edit]

Tentacled flatheads are mottled brown or green and grey, coloured ideally to be camouflaged with their habitat. They have eye lappets, which help to break up the outline of the iris and improve camouflage, and can reach a length of 70cm.

Habitat[edit]

Papilloculiceps longiceps and Cymbacephalus beauforti are the two species of the Platycephalidae family which resemble crocodiles most

Tentacled flatheads dwell in areas where the sea floor is soft or sandy and their camouflage is most effective, usually associated with reefs or rubble.

Diet[edit]

Tentacled flatheads are carnivorous, and will eat most fish small enough to fit in their mouth.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!