Overview

Comprehensive Description

Biology

Oviparous (Ref. 205). Eggs are encased in horny shells (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Widespread throughout New Zealand.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

New Zealand.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southwest Pacific: New Zealand.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Max. size

112 cm TL (male/unsexed; (Ref. 45044))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Pale brown coloration fading to white ventrally. Dorsal fin spine reaching to origin of second dorsal fin when depressed; elongated second dorsal fin not indented along its length. Horizontal and hyomandibular lateral line canals sharing a common branch. Caudal filament long and stout (Ref. 45044).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Inhabits upper and mid continental slope over soft sediments. Feeds on benthic invertebrates. Pale ghost sharks lay eggs in hard cases, depositing them in pairs on the seabed. Males mature at 60 cm caudal length (CL) (snout to posterior end of upper caudal fin) and females at 70 cm CL. Maximum length is about 90 cm CL.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathydemersal; marine; depth range 400 - 1100 m (Ref. 45044), usually 500 - 700 m (Ref. 45044)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 7160 specimens in 1 taxon.
Water temperature and chemistry ranges based on 5888 samples.

Environmental ranges
  Depth range (m): 86.5 - 1410
  Temperature range (°C): 2.457 - 16.626
  Nitrate (umol/L): 4.585 - 36.605
  Salinity (PPS): 34.093 - 35.461
  Oxygen (ml/l): 3.879 - 6.736
  Phosphate (umol/l): 0.449 - 2.492
  Silicate (umol/l): 0.000 - 67.456

Graphical representation

Depth range (m): 86.5 - 1410

Temperature range (°C): 2.457 - 16.626

Nitrate (umol/L): 4.585 - 36.605

Salinity (PPS): 34.093 - 35.461

Oxygen (ml/l): 3.879 - 6.736

Phosphate (umol/l): 0.449 - 2.492

Silicate (umol/l): 0.000 - 67.456
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Hydrolagus sp. E

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Hydrolagus bemisi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTCTACCTCCTTTTCGGTGCTTGAGCAGGAATAGTAGGGACTGCCCTTAGCCTGTTAATCCGAGCTGAGCTGAACCAGCCCGGCGCCCTAATGGGGGATGATCAGATTTATAATGTTGTTGTTACTGCCCACGCTTTTGTGATAATTTTCTTCATAGTAATACCCATTATGATTGGAGGATTTGGAAATTGACTTGTACCTTTGATAATTGGAGCACCTGATATAGCCTTCCCCCGAATAAATAACATAAGTTTTTGACTCCTCCCCCCTTCTTTCCTCTTACTCCTAGCATCAGCAGGGGTGGAAGCAGGCGCCGGCACCGGATGAACGGTCTACCCCCCTCTAGCTGGAAATCTAGCACATGCCGGAGCATCTGTAGATCTGACCATTTTCTCCCTTCACTTAGCCGGAATCTCTTCAATTCTAGCCTCCATCAACTTCATTACTACAATTATTAATATAAAACCTCCATCGATTACCCAATATCAGACCCCCTTATTCGTGTGATCTATTCTAATTACTACAGTCCTTCTATTACTTTCTTTACCTGTTCTAGCAGCCGGCATTACAATATTACTCACAGACCGCAATCTTAATACTACATTCTTCGACCCGGCAGGAGGAGGGGATCCAATTTTATACCAACACTTANNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hydrolagus bemisi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hydrolagus sp. D

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hydrolagus sp. b

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hydrolagus sp.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2003

Assessor/s
Francis, M.P. (SSG Australia & Oceania Regional Workshop, March 2003)

Reviewer/s
Fowler, S., Kyne, P.M. & Cavanagh, R.D. (Shark Red List Authority)

Contributor/s

Justification
An endemic species with a widespread distribution throughout New Zealand. Caught commercially by bottom trawlers (ca 1,700 tonnes per year), but managed by ITQs since 1998. Productivity unknown but may be low. Biomass indices relatively stable in 200 to 800 m depth range, but declining in 750 to 1,500 m depth range, on the Chatham Rise. The 200 to 800 m depth range encompasses the main habitat depth range (500 to 900 m), so the overall population abundance is probably relatively stable.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Depth range 86 to 1,410 m; most abundant in 500 to 900 m. Trawl survey indices (1992 to 2000) from Chatham Rise in 200 to 800 m depth range show no change, but indices (1984 to 1994) from the Chatham Rise in 750 to 1,500 m show a decline.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Large commercial catch of around 1,700 tonnes per year in bottom trawl fishery. Trawl survey indices (1992 to 2000) from Chatham Rise in 200 to 800 m depth range (the main habitat depth range of this species) show no change, but indices (1984 to 1994) from the Chatham Rise in 750 to 1,500 m show a decline.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Managed under ITQs since 1998.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pale ghost shark

The pale ghost shark, Hydrolagus bemisi, is a shortnose chimaera of the family Chimaeridae. Its length is up to one metre.

References[edit]

  • Froese, Rainer and Pauly, Daniel, eds. (2006). "Hydrolagus bemisi" in FishBase. March 2006 version.
  • Tony Ayling & Geoffrey Cox, Collins Guide to the Sea Fishes of New Zealand, (William Collins Publishers Ltd, Auckland, New Zealand 1982) ISBN 0-00-216987-8
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!