Overview

Comprehensive Description

General Description

Petrocephalus microphthalmus is a small (possibly the smallest) species of Petrocephalus (larger specimen ever collected = 73.7 mm standard length). Body ovoid, body 2.6-2.8 longer than high and laterally compressed. Head length between 3.8 and 4.0 times in standard length. Snout short and round. Mouth small (3.6 ≤ head length/mouth width ≤ 4.2, holotype = 3.8), opening under the eye. Teeth small and bicuspid, 9–11 (holotype = 10) in a single row in the upper jaw, 14–20 (holotype = 20) in a single row in the lower jaw. Dorsal and anal fins originate in the posterior half of the body (standard lengthp/pre–dorsal distance = 1.5 and standard length/pre–anal distance = 1.7). Pre–dorsal distance slightly greater than pre–anal distance. Dorsal fin with 16–18 branched rays (holotype = 16). Anal fin with 25–27 branched rays (holotype = 25). Scales cover the entire body, except for the head. Lateral line visible and complete with 34 to 36 pored scales along its length (holotype = 36). Eight to 10 scales between the anterior base of the anal fin and the lateral line. Twelve scales around the caudal peduncle. Skin on head thick, becoming opaque with formalin fixation, containing numerous Knollenorgan electroreceptors which do not form "rosettes" in their typical positions. Instead, Knollenorgans appear as isolated receptor pores in the skin covering the head, the character state observed in the Mormyrinae.

Body generally blue–gray, with the dorsum darker than the abdomen. Numerous chromatophores occur below the skin surface. This species can appear metallic blue to violet depending on the angle and intensity of illumination. The color is especially intense on the operculum. The fins are translucent except for the first dorsal fin rays, which are black near their insertion.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lavoué, Sébastien

Source: Africhthy

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Africa: Sanaga River in the north to the more southern Kouilou-Niari River, including, Ntem River and Ogowe River (Ref. 85331). Also in Congo River (Ref. 85331).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Petrocephalus microphthalmus is known from Pool Malebo (Stanley Pool) and from the Central Congo River basin. It also occurs in the Lower Guinea region, where it is the most common Petrocephalus species: it is present from the Sanaga River (Cameroon) to the Niari Kouilou River (Congo).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Present in Congo and Lower Guinea provinces. Holotype from Gabon. Locally very abundant. In the Congo basin Petrocephalus microphthalmus is present in the Lower Congo River in the vicinity of Brazzaville. In the Lower Guinea province this species is widespread throughout the entire Ogooué and Ntem basins in Gabon, including streams and lakes associated with main river channels (e.g., Lac Zilé). It can also be found along the coastal region from the Sanaga River (Cameroon) in the north to the more southern Niari–Kouilou River (Republic of Congo).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lavoué, Sébastien

Source: Africhthy

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

West-central Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal soft rays (total): 18 - 21; Analsoft rays: 25 - 29
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 52 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

5.2 cm TL (male/unsexed; (Ref. 11970))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 73.7 mm SL

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lavoué, Sébastien

Source: Africhthy

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Petrocephalus microphthalmus is distinguished from all other Petrocephalus species in Central Africa by the following combination of characteristics: short dorsal fin with only 18 or fewer branched rays, long anal fin with 23-27 branched rays, eye small (HL/ED=4,1-4,8), mouth moderately wide, only 9-11 teeth in the upper jaw, 14-20 teeth in the lower jaw, no more than 10 scales between the anterior base of the anal fin and the lateral line (Ref. 52344, 85331). Absence of black pigment patches, except for a characteristic black blotch on the anterior dorsal fin rays near the origin of this fin; body silvery/purplish, iridescent (Ref. 85331).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Petrocephalus microphthalmus is distinguished from all other Petrocephalus species in Central Africa by the following combination of characteristics. Short dorsal fin with only 18 or fewer branched rays (range 15–18). Longer anal fin with 23–27 branched rays. Eye small (4.0 ≤ Head length/eye diameter, range = 4.1–4.8). Mouth moderately wide (3.5 ≤ Head length /mouth width ≤ 4.9). Only 9–11 teeth in the upper jaw, 14–20 teeth in the lower jaw. Absence of black pigment patches, except for a characteristic black blotch on the anterior dorsal fin rays near the origin of this fin. Body silvery/purplish, iridescent.

Electroreceptors on the head are not clustered into "rosettes" but, instead, appear as isolated receptor pores. EOD of normal polarity with two main phases and, in Odzala, a third minute phase of very low amplitude.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lavoué, Sébastien

Source: Africhthy

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This is a demersal species.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Ecology

In Odzala, P. microphthalmus prefers small tributary creeks flowing through forest. In Loa Loa, it does not show strong ecological preference.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lavoué, Sébastien

Source: Africhthy

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Electric Organ Discharge

Petrocephalus microphthalmus produces EODs of short duration, which is typical of the entire genus. No sex differences have yet been reported in any population. Similar EOD durations have been observed in the Odzala population of P. microphthalmus (range = 0.252 – 0.511 msec) and among conspecifics from Gabon (range = 0.380 – 0.561 msec). A relatively long, slow rise characterizes the initial part of the first head–positive phase in EODs recorded from the Odzala population, often resulting in a shoulder early during the waveform’s head-positive rise to P1, the first main peak. The early head-positive rise and shoulder are very low in amplitude, however, such that they may only be apparent at high amplifier gain. These subtle waveform features appear to be uncommon in EODs of other Petrocephalus species. A similar slow rise (and shoulder) preceding P1 has been recorded among a small number of P. microphthalmus individuals from Gabon, but it seems to be much less common than in Odzala.

Based on histological examination, electrocytes are known to be type NPp.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lavoué, Sébastien

Source: Africhthy

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Evolution

Phylogenetic Relationships

P. microphthalmus is the sister group of the rest of Petrocephalus. Genetically, P. microphthalmus is very distinct from the rest, as well.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lavoué, Sébastien

Source: Africhthy

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Petrocephalus microphthalmus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTAGTATTTGGTGCTTGAGCTGGAATAGTAGGCACTGCGCTAAGTCTCCTCATCCGAGCAGAGCTAAACCAACCAGGAGCCCTACTTGGCGACGACCAGATTTATAATGTGATCGTCACCGCACACGCCTTTGTAATGATTTTCTTCATGGTAATACCAATTATAATTGGAGGCTTCGGCAACTGACTAATTCCACTTATGCTCGGTGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTATTACCCCCATCATTCCTCCTTCTTCTTGCCTCCTCAGGAGTAGAAGCAGGTGTTGGAACCGGCTGAACAGTTTACCCCCCACTAGCTGGCAACCTGGCCCATGCCGGAGCCTCAGTTGATTTGGCCATCTTCTCCCTCCATTTAGCAGGAGTATCCTCCATCCTAGGCTCAATCAACTTCATTACCACAATCATTAATATGAAACCCCCAGCAATTTCACAATATCAAACCCCCCTATTTATTTGAGCCCTATTAATCACCACTGTCCTACTTCTTCTGTCACTACCCGTTCTAGCCGCAGGCATTACTATGTTATTAACGGACCGAAACCTGAACACAACATTCTTTGACCCAGCCGGCGGAGGAGACCCAATTCTCTACCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Petrocephalus microphthalmus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Moelants, T.

Reviewer/s
Brummett, R., Mbe Tawe, A.N., Dening Touokong, C., Reid, G.M., Snoeks, J. Staissny, M., Moelants, T., Mamonekene, V., Ndodet, B., Ifuta, S.N.B., Chilala, A., Monsembula, R., Ibala Zamba, A., Opoye Itoua, O., Pouomogne, V., Darwall, W. & Smith, K.

Contributor/s

Justification
The species is widespread without major threats throughout central Africa and is assessed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
No information available.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
None known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
None known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!