Table of Contents
Overview
Comprehensive Description
Biology
Mesopelagic (Ref. 58302). Minimum depth from Ref. 58018.
-
Nielsen, J.G. and D.G. Smith 1978 The eel family Nemichthyidae (Pisces, Anguilliformes). Carlsberg Found., Dana-Rept. No. 88:71 p. (Ref. 7450)
http://www.fishbase.org/references/FBRefSummary.php?id=7450&speccode=2660
© FishBase
Source:
FishBase
Trusted
Distribution
Eastern Pacific: Oregon, USA to central Mexico, including the Gulf of California; also Hawaii and north of Hawaii to about 38°N.
-
Nielsen, J.G. and D.G. Smith 1978 The eel family Nemichthyidae (Pisces, Anguilliformes). Carlsberg Found., Dana-Rept. No. 88:71 p. (Ref. 7450)
http://www.fishbase.org/references/FBRefSummary.php?id=7450&speccode=2660
© FishBase
Source:
FishBase
Trusted
Central and Eastern Pacific: Hawaiian Islands; Oregon (U. S. A.) to Gulf of California (Mexico).
© FishWise Professional
Source:
FishWise Professional
Trusted
Physical Description
Morphology
Dorsal soft rays (total): 173 - 222; Analsoft rays: 164 - 208
-
Nielsen, J.G. and D.G. Smith 1978 The eel family Nemichthyidae (Pisces, Anguilliformes). Carlsberg Found., Dana-Rept. No. 88:71 p. (Ref. 7450)
http://www.fishbase.org/references/FBRefSummary.php?id=7450&speccode=2660
© FishBase
Source:
FishBase
Trusted
Size
Max. size
161 cm TL (male/unsexed; (Ref. 40789))
-
Smith, D.G. 1994 Catalog of type specimens of recent fishes in the National Museum of Natural History, Smithsonian Institution, 6: Anguilliformes, Saccopharyngiformes, and Notacanthiformes (Teleostei: Elopomorpha). Smithson. Contrib. 566:50 p. (Ref. 40789)
http://www.fishbase.org/references/FBRefSummary.php?id=40789&speccode=58525
© FishBase
Source:
FishBase
Trusted
Diagnostic Description
Most easily distinguished from N. scolopaceus by its pale color; has more postorbital and preopercular pores. Rectangle formed by the lateral line pores is shorter and higher than in scolopaceus. Resembles N. curvirostris in its pale color but the subcutaneous dark bars are not as evident. May be instantly distinguished from curvirostris by the more numerous postorbital and preopercular pores and the much shorter and higher rectangle formed by the lateral line pores. Has smaller teeth than curvirostris.
-
Nielsen, J.G. and D.G. Smith 1978 The eel family Nemichthyidae (Pisces, Anguilliformes). Carlsberg Found., Dana-Rept. No. 88:71 p. (Ref. 7450)
http://www.fishbase.org/references/FBRefSummary.php?id=7450&speccode=2660
© FishBase
Source:
FishBase
Trusted
Type Information
Paratype for Nemichthys larseni Nielsen & Smith
Catalog Number: USNM 219543
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): T. Clarke
Year Collected: 1970
Locality: Hawaii, United States, Hawaiian Islands, Pacific
Depth (m): 190
Catalog Number: USNM 219543
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): T. Clarke
Year Collected: 1970
Locality: Hawaii, United States, Hawaiian Islands, Pacific
Depth (m): 190
- Paratype: Nielsen, J. G. & Smith, D. G. 1978. Dana Report. No. 88: 54, 34, 35.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Paratype for Nemichthys larseni Nielsen & Smith
Catalog Number: USNM 219542
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): T. Clarke
Year Collected: 1969
Locality: Hawaii, United States, Hawaiian Islands, Pacific
Depth (m): 800
Catalog Number: USNM 219542
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): T. Clarke
Year Collected: 1969
Locality: Hawaii, United States, Hawaiian Islands, Pacific
Depth (m): 800
- Paratype: Nielsen, J. G. & Smith, D. G. 1978. Dana Report. No. 88: 54, 34, 35.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Paratype for Nemichthys larseni Nielsen & Smith
Catalog Number: USNM 219537
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): F. Berry
Year Collected: 1962
Locality: California, United States, Pacific
Vessel: Black Douglas
Catalog Number: USNM 219537
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): F. Berry
Year Collected: 1962
Locality: California, United States, Pacific
Vessel: Black Douglas
- Paratype: Nielsen, J. G. & Smith, D. G. 1978. Dana Report. No. 88: 54, 34, 35.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Holotype for Nemichthys larseni Nielsen & Smith
Catalog Number: USNM 217376
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1966
Locality: Baja California, Mexico, Pacific
Depth (m): 170
Catalog Number: USNM 217376
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1966
Locality: Baja California, Mexico, Pacific
Depth (m): 170
- Holotype: Nielsen, J. G. & Smith, D. G. 1978. Dana Report. No. 88: 54, 34, 35.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Paratype for Nemichthys larseni Nielsen & Smith
Catalog Number: USNM 219539
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1962
Locality: California, United States, Pacific
Depth (m): 298 to 298
Vessel: Horizon
Catalog Number: USNM 219539
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1962
Locality: California, United States, Pacific
Depth (m): 298 to 298
Vessel: Horizon
- Paratype: Nielsen, J. G. & Smith, D. G. 1978. Dana Report. No. 88: 54, 34, 35.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Paratype for Nemichthys larseni Nielsen & Smith
Catalog Number: USNM 219538
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1962
Locality: California, United States, Pacific
Depth (m): 24 to 24
Vessel: John N. Cobb
Catalog Number: USNM 219538
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1962
Locality: California, United States, Pacific
Depth (m): 24 to 24
Vessel: John N. Cobb
- Paratype: Nielsen, J. G. & Smith, D. G. 1978. Dana Report. No. 88: 54, 34, 35.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Ecology
Habitat
Environment
bathypelagic; marine; depth range 0 - 1000 m (Ref. 58302)
-
Mundy, B.C. 2005 Checklist of the fishes of the Hawaiian Archipelago. Bishop Museum Bulletins in Zoology. Bishop Mus. Bull. Zool. (6):1-704. (Ref. 58302)
http://www.fishbase.org/references/FBRefSummary.php?id=58302&speccode=46
© FishBase
Source:
FishBase
Trusted
Depth range based on 10 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.
Environmental ranges
Depth range (m): 24 - 1350
Temperature range (°C): 6.146 - 14.018
Nitrate (umol/L): 2.135 - 39.893
Salinity (PPS): 33.180 - 34.284
Oxygen (ml/l): 0.481 - 5.885
Phosphate (umol/l): 0.556 - 3.063
Silicate (umol/l): 4.670 - 76.481
Graphical representation
Depth range (m): 24 - 1350
Temperature range (°C): 6.146 - 14.018
Nitrate (umol/L): 2.135 - 39.893
Salinity (PPS): 33.180 - 34.284
Oxygen (ml/l): 0.481 - 5.885
Phosphate (umol/l): 0.556 - 3.063
Silicate (umol/l): 4.670 - 76.481
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 4 samples.
Environmental ranges
Depth range (m): 24 - 1350
Temperature range (°C): 6.146 - 14.018
Nitrate (umol/L): 2.135 - 39.893
Salinity (PPS): 33.180 - 34.284
Oxygen (ml/l): 0.481 - 5.885
Phosphate (umol/l): 0.556 - 3.063
Silicate (umol/l): 4.670 - 76.481
Graphical representation
Depth range (m): 24 - 1350
Temperature range (°C): 6.146 - 14.018
Nitrate (umol/L): 2.135 - 39.893
Salinity (PPS): 33.180 - 34.284
Oxygen (ml/l): 0.481 - 5.885
Phosphate (umol/l): 0.556 - 3.063
Silicate (umol/l): 4.670 - 76.481
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Nemichthys larseni
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTCTACCTAGTATTCGGTGCCTGAGCTGGGATAGTGGGGACAGCACTTAGCCTGCTAATCCGTGCTGAACTCAGCCAGCCGGGTGCCCTCTTAGGAGACGATCAAATCTACAACGTTATTGTCACGGCCCATGCCTTCGTGATAATTTTCTTTATAGTAATGCCCGTCATGATTGGAGGGTTTGGGAACTGACTTATCCCTTTAATGATCGGTGCCCCAGACATAGCATTCCCCCGGATGAACAACATAAGCTTTTGACTCCTTCCCCCTTCATTTCTTTTGCTCCTAGCTTCCTCTGGTGTAGAAGCAGGAGCGGGGACAGGCTGAACGGTGTACCCCCCTCTAGCCGGGAACTTGGCACATGCAGGAGCATCTGTAGACCTCACAATCTTCTCCCTCCACCTTGCAGGCATCTCGTCGATCTTAGGAGCTATCAACTTTATCACCACAATTATTAACATAAAACCCCCTGCTATCACCCAATACCAAACACCTTTATTTGTATGGGCAGTGCTAGTTACGGCTGTGCTCCTTCTCCTCTCCCTGCCCGTCCTAGCTGCGGGGATTACAATACTTTTAACAGACCGAAACCTGAATACAACTTTTTTTGATCCCGCAGGGGGGGGAGACCCTATCCTTTATCAACACTTA
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Nemichthys larseni
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
© FishBase
Source:
FishBase
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
