Overview

Comprehensive Description

Biology

Mesopelagic (Ref. 58302). Minimum depth from Ref. 58018.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Eastern Pacific: Oregon, USA to central Mexico, including the Gulf of California; also Hawaii and north of Hawaii to about 38°N.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Central and Eastern Pacific: Hawaiian Islands; Oregon (U. S. A.) to Gulf of California (Mexico).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal soft rays (total): 173 - 222; Analsoft rays: 164 - 208
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Max. size

161 cm TL (male/unsexed; (Ref. 40789))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Most easily distinguished from N. scolopaceus by its pale color; has more postorbital and preopercular pores. Rectangle formed by the lateral line pores is shorter and higher than in scolopaceus. Resembles N. curvirostris in its pale color but the subcutaneous dark bars are not as evident. May be instantly distinguished from curvirostris by the more numerous postorbital and preopercular pores and the much shorter and higher rectangle formed by the lateral line pores. Has smaller teeth than curvirostris.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Nemichthys larseni Nielsen & Smith
Catalog Number: USNM 219543
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): T. Clarke
Year Collected: 1970
Locality: Hawaii, United States, Hawaiian Islands, Pacific
Depth (m): 190
  • Paratype: Nielsen, J. G. & Smith, D. G. 1978. Dana Report. No. 88: 54, 34, 35.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Nemichthys larseni Nielsen & Smith
Catalog Number: USNM 219542
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): T. Clarke
Year Collected: 1969
Locality: Hawaii, United States, Hawaiian Islands, Pacific
Depth (m): 800
  • Paratype: Nielsen, J. G. & Smith, D. G. 1978. Dana Report. No. 88: 54, 34, 35.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Nemichthys larseni Nielsen & Smith
Catalog Number: USNM 219537
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): F. Berry
Year Collected: 1962
Locality: California, United States, Pacific
Vessel: Black Douglas
  • Paratype: Nielsen, J. G. & Smith, D. G. 1978. Dana Report. No. 88: 54, 34, 35.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Holotype for Nemichthys larseni Nielsen & Smith
Catalog Number: USNM 217376
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1966
Locality: Baja California, Mexico, Pacific
Depth (m): 170
  • Holotype: Nielsen, J. G. & Smith, D. G. 1978. Dana Report. No. 88: 54, 34, 35.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Nemichthys larseni Nielsen & Smith
Catalog Number: USNM 219539
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1962
Locality: California, United States, Pacific
Depth (m): 298 to 298
Vessel: Horizon
  • Paratype: Nielsen, J. G. & Smith, D. G. 1978. Dana Report. No. 88: 54, 34, 35.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Nemichthys larseni Nielsen & Smith
Catalog Number: USNM 219538
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1962
Locality: California, United States, Pacific
Depth (m): 24 to 24
Vessel: John N. Cobb
  • Paratype: Nielsen, J. G. & Smith, D. G. 1978. Dana Report. No. 88: 54, 34, 35.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

bathypelagic; marine; depth range 0 - 1000 m (Ref. 58302)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 10 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 24 - 1350
  Temperature range (°C): 6.146 - 14.018
  Nitrate (umol/L): 2.135 - 39.893
  Salinity (PPS): 33.180 - 34.284
  Oxygen (ml/l): 0.481 - 5.885
  Phosphate (umol/l): 0.556 - 3.063
  Silicate (umol/l): 4.670 - 76.481

Graphical representation

Depth range (m): 24 - 1350

Temperature range (°C): 6.146 - 14.018

Nitrate (umol/L): 2.135 - 39.893

Salinity (PPS): 33.180 - 34.284

Oxygen (ml/l): 0.481 - 5.885

Phosphate (umol/l): 0.556 - 3.063

Silicate (umol/l): 4.670 - 76.481
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nemichthys larseni

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTAGTATTCGGTGCCTGAGCTGGGATAGTGGGGACAGCACTTAGCCTGCTAATCCGTGCTGAACTCAGCCAGCCGGGTGCCCTCTTAGGAGACGATCAAATCTACAACGTTATTGTCACGGCCCATGCCTTCGTGATAATTTTCTTTATAGTAATGCCCGTCATGATTGGAGGGTTTGGGAACTGACTTATCCCTTTAATGATCGGTGCCCCAGACATAGCATTCCCCCGGATGAACAACATAAGCTTTTGACTCCTTCCCCCTTCATTTCTTTTGCTCCTAGCTTCCTCTGGTGTAGAAGCAGGAGCGGGGACAGGCTGAACGGTGTACCCCCCTCTAGCCGGGAACTTGGCACATGCAGGAGCATCTGTAGACCTCACAATCTTCTCCCTCCACCTTGCAGGCATCTCGTCGATCTTAGGAGCTATCAACTTTATCACCACAATTATTAACATAAAACCCCCTGCTATCACCCAATACCAAACACCTTTATTTGTATGGGCAGTGCTAGTTACGGCTGTGCTCCTTCTCCTCTCCCTGCCCGTCCTAGCTGCGGGGATTACAATACTTTTAACAGACCGAAACCTGAATACAACTTTTTTTGATCCCGCAGGGGGGGGAGACCCTATCCTTTATCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nemichthys larseni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!