Overview

Comprehensive Description

Biology

Occurs among rubble deposits on the lee side of shallow wave-washed reefs. Feeds on crustaceans (Ref. 9710, 58302). Benthic (Ref. 58302).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa to the Line and Tuamoto islands, north to Johnston Island.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: Aldabra and East Africa; Marshall Islands and Tonga east to Hawaiian Islands and Johnston Island, south to New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0; Vertebrae: 121 - 130
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 750 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

75.0 cm TL (male/unsexed; (Ref. 1602))
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Plain brown in color, snout with white tip, jaw with irregular white patches; darker behind eye and corner of mouth (Ref. 3257). Stout conical teeth that tend to become pebble-like, more numerous, and closely-packed with age.Description: Characterized by having vomer with ovate patch of teeth (5-6 teeth across broadest point) in large adult, two rows of small molariform teeth in smaller eels (Ref 90102).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Occurs among rubble deposits on the lee side of shallow wave-washed reefs. Feeds on crustaceans (Ref. 9710).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; freshwater; brackish; marine; depth range 0 - 24 m (Ref. 9710)
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 21 specimens in 1 taxon.
Water temperature and chemistry ranges based on 19 samples.

Environmental ranges
  Depth range (m): 0.305 - 13.725
  Temperature range (°C): 25.245 - 29.336
  Nitrate (umol/L): 0.130 - 2.714
  Salinity (PPS): 34.134 - 36.148
  Oxygen (ml/l): 4.454 - 4.757
  Phosphate (umol/l): 0.092 - 0.507
  Silicate (umol/l): 1.057 - 4.752

Graphical representation

Depth range (m): 0.305 - 13.725

Temperature range (°C): 25.245 - 29.336

Nitrate (umol/L): 0.130 - 2.714

Salinity (PPS): 34.134 - 36.148

Oxygen (ml/l): 4.454 - 4.757

Phosphate (umol/l): 0.092 - 0.507

Silicate (umol/l): 1.057 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 24m.
Recorded at 24 meters.

Habitat: reef-associated. Occurs among rubble deposits on the lee side of shallow wave-washed reefs. Feeds on crustaceans (Ref. 9710).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Echidna leucotaenia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTGTATTTAGTATTTGGAGCCTGAGCCGGAATGGTCGGCACCGCATTGAGCCTATTAATCCGAGCAGAACTAAGTCAGCCCGGGGCCCTACTAGGTGATGACCAAATTTATAATGTAATTGTAACAGCCCATGCTTTCGTAATAATTTTCTTTATAGTAATGCCAATTATAATCGGTGGCTTCGGAAACTGACTTATTCCCCTAATGATTGGAGCCCCAGACATAGCATTTCCTCGAATAAATAATATAAGCTTCTGACTCCTTCCTCCTTCATTTCTTCTACTTTTAGCTTCTTCTGGTGTCGAAGCAGGAGCTGGTACCGGATGAACTGTTTATCCCCCTCTAGCGGGAAATCTAGCTCACGCCGGAGCATCTGTTGATTTAACCATTTTTTCTCTTCATTTAGCAGGAGTTTCTTCAATTCTAGGAGCAATCAACTTTATTACAACCATTATTAACATAAAACCCCCTGCTATTACACAATACCAAACACCATTGTTTGTATGAGCAGTCTTAGTAACAGCAGTTCTTCTTCTACTCTCCCTACCAGTTCTAGCCGCTGGTATTACAATACTTTTAACAGACCGAAACCTAAATACAACCTTCTTTGACCCTGCAGGGGGAGGTGATCCAATTCTTTATCAACACTTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Echidna leucotaenia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Echidna leucotaenia

Echidna leucotaenia, the whiteface moray, also known as the white-banded moray eel,[1] is a moray eel (family Muraenidae).[2] It was described by Schultz in 1943.[3] It is a tropical, marine and freshwater eel which is known from the Indo-Pacific, including East Africa, the Line islands, the Tuamoto islands, and Johnston Island. It dwells at a depth range of 0 to 24 metres (0 to 79 ft), and leads a benthic lifestyle in reefs. Males can reach a maximum total length of 75 centimetres (30 in).[2]

The whiteface moray's diet consists primarily of crabs.[4]

References[edit]

  1. ^ Common names for Echidna leucotaenia at www.fishbase.org.
  2. ^ a b Echidna leucotaenia at www.fishbase.org.
  3. ^ Schultz, L. P., 1943 (20 Jan.) [ref. 3957] Fishes of the Phoenix and Samoan islands collected in 1939 during the expedition of the U. S. S. "Bushnell.". Bulletin of the United States National Museum No. 180: i-x + 1-316, Pls. 1-9.
  4. ^ Food items reported for Echidna leucotaenia at www.fishbase.org.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Whiteface moray

The Whiteface moray (Echidna leucotaenia, also known as the White-banded moray eel.[1]) is a moray eel (family Muraenidae).[2] It was described by Schultz in 1943.[3] It is a tropical, marine and freshwater eel which is known from the Indo-Pacific, including East Africa, the Line islands, the Tuamoto islands, and Johnston Island. It dwells at a depth range of 0 to 24 metres (0 to 79 ft), and leads a benthic lifestyle in reefs.Males can reach a maximum total length of 75 centimetres (30 in).[2]

The Whiteface moray's diet consists primarily of crabs.[4]

References[edit]

  1. ^ Common names for Echidna leucotaenia at www.fishbase.org.
  2. ^ a b Echidna leucotaenia at www.fishbase.org.
  3. ^ Schultz, L. P., 1943 (20 Jan.) [ref. 3957] Fishes of the Phoenix and Samoan islands collected in 1939 during the expedition of the U. S. S. "Bushnell.". Bulletin of the United States National Museum No. 180: i-x + 1-316, Pls. 1-9.
  4. ^ Food items reported for Echidna leucotaenia at www.fishbase.org.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!