Overview

Comprehensive Description

Biology

Occurs among rubble deposits on the lee side of shallow wave-washed reefs. Feeds on crustaceans (Ref. 9710, 58302). Benthic (Ref. 58302).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa to the Line and Tuamoto islands, north to Johnston Island.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: Aldabra and East Africa; Marshall Islands and Tonga east to Hawaiian Islands and Johnston Island, south to New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0; Vertebrae: 121 - 124
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 750 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

75.0 cm TL (male/unsexed; (Ref. 1602))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Occurs among rubble deposits on the lee side of shallow wave-washed reefs. Feeds on crustaceans (Ref. 9710).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Plain brown in color, snout with white tip, jaw with irregular white patches; darker behind eye and corner of mouth (Ref. 3257). Stout conical teeth that tend to become pebble-like, more numerous, and closely-packed with age.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; brackish; marine; depth range 0 - 24 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 21 specimens in 1 taxon.
Water temperature and chemistry ranges based on 19 samples.

Environmental ranges
  Depth range (m): 0.305 - 13.725
  Temperature range (°C): 25.245 - 29.336
  Nitrate (umol/L): 0.130 - 2.714
  Salinity (PPS): 34.134 - 36.148
  Oxygen (ml/l): 4.454 - 4.757
  Phosphate (umol/l): 0.092 - 0.507
  Silicate (umol/l): 1.057 - 4.752

Graphical representation

Depth range (m): 0.305 - 13.725

Temperature range (°C): 25.245 - 29.336

Nitrate (umol/L): 0.130 - 2.714

Salinity (PPS): 34.134 - 36.148

Oxygen (ml/l): 4.454 - 4.757

Phosphate (umol/l): 0.092 - 0.507

Silicate (umol/l): 1.057 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 24m.
Recorded at 24 meters.

Habitat: reef-associated. Occurs among rubble deposits on the lee side of shallow wave-washed reefs. Feeds on crustaceans (Ref. 9710).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Echidna leucotaenia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTGTATTTAGTATTTGGAGCCTGAGCCGGAATGGTCGGCACCGCATTGAGCCTATTAATCCGAGCAGAACTAAGTCAGCCCGGGGCCCTACTAGGTGATGACCAAATTTATAATGTAATTGTAACAGCCCATGCTTTCGTAATAATTTTCTTTATAGTAATGCCAATTATAATCGGTGGCTTCGGAAACTGACTTATTCCCCTAATGATTGGAGCCCCAGACATAGCATTTCCTCGAATAAATAATATAAGCTTCTGACTCCTTCCTCCTTCATTTCTTCTACTTTTAGCTTCTTCTGGTGTCGAAGCAGGAGCTGGTACCGGATGAACTGTTTATCCCCCTCTAGCGGGAAATCTAGCTCACGCCGGAGCATCTGTTGATTTAACCATTTTTTCTCTTCATTTAGCAGGAGTTTCTTCAATTCTAGGAGCAATCAACTTTATTACAACCATTATTAACATAAAACCCCCTGCTATTACACAATACCAAACACCATTGTTTGTATGAGCAGTCTTAGTAACAGCAGTTCTTCTTCTACTCTCCCTACCAGTTCTAGCCGCTGGTATTACAATACTTTTAACAGACCGAAACCTAAATACAACCTTCTTTGACCCTGCAGGGGGAGGTGATCCAATTCTTTATCAACACTTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Echidna leucotaenia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Echidna leucotaenia

Echidna leucotaenia is a moray eel found in coral reefs in the Pacific and Indian Oceans.[1] It was first named by Schultz in 1943,[1] and is commonly known as the whiteface moray or the white-banded moray eel.[2]

References

  1. ^ a b Echidna leucotaenia at www.fishbase.org.
  2. ^ Common names for Echidna leucotaenia at www.fishbase.org.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!