Overview

Comprehensive Description

Biology

Adults inhabit coastal reefs and lagoons on sand and rubble margins of algal reefs and sometimes near seagrass beds (Ref. 48637). Feed by sifting mouthfuls of sand and expelling it through the gills, to capture small invertebrates, organic matter, and large quantities of algae. Monogamous (Ref. 52884). Spawning is synchronous with semilunar periods (Ref. 84980). Eggs are deposited in burrows which are tended by the male parent (Ref. 55919, 84980). Minimum depth reported from Ref. 27115. Also Ref. 58652.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Gazi Bay
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pacific Ocean: Philippines to the Society Islands, north to Ryukyu Islands, south to southern Australia (including Lord Howe Island) and Rapa Island; throughout Micronesia. Replaced by Amblygobius albimaculatus in the Red Sea and Amblygobius semicinctus in the western Indian Ocean (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 14; Analspines: 1; Analsoft rays: 14
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 150 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

15.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 2 - 20 m (Ref. 1602), usually 2 - 20 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 126 specimens in 1 taxon.
Water temperature and chemistry ranges based on 97 samples.

Environmental ranges
  Depth range (m): 0.15 - 30
  Temperature range (°C): 22.496 - 29.325
  Nitrate (umol/L): 0.043 - 1.204
  Salinity (PPS): 32.183 - 35.837
  Oxygen (ml/l): 4.388 - 5.079
  Phosphate (umol/l): 0.055 - 0.441
  Silicate (umol/l): 0.983 - 15.721

Graphical representation

Depth range (m): 0.15 - 30

Temperature range (°C): 22.496 - 29.325

Nitrate (umol/L): 0.043 - 1.204

Salinity (PPS): 32.183 - 35.837

Oxygen (ml/l): 4.388 - 5.079

Phosphate (umol/l): 0.055 - 0.441

Silicate (umol/l): 0.983 - 15.721
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 2 - 20m.
From 2 to 20 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits sandy or rubble areas of subtidal reef flats and lagoons and constructs a burrow under a rock or rubble. Feeds by sifting mouthfuls of sand and expelling it through the gills, to capture small invertebrates, organic matter, and large quantities of algae. Feeds on small invertebrates, algae and organic matter (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Are monogamous. Although a few pairs changed partners, most pairs remained together over successive rounds of spawnings according to a study (Ref. 84980). Spawning cycle is semilunar. Males construct burrows where the eggs are deposited. Only the males guard the burrows, occassionaly fanning the eggs to provide oxygenated sea water to the burrow. They do this about 41% of the time at the expense of feeding. Egg guarding lasts for 3-4 days after which the eggs hatch in time for the full or new moon phases (Ref. 84980). Parental care shifted from male to female in a study where the male parent was removed from the burrow which according to the study could be attributed to the spatial closeness of the parents and no requirement of special structures for guarding the offsprings (Ref. ).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Amblygobius phalaena

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTCTACCTTGTATTCGGTGCCTGGGCCGGGATGGTAGGCACGGCACTAAGCCTTCTGATCCGGGCCGAACTTAGTCAACCTGGCGCATTACTAGGCGATGACCAAATTTACAATGTAATCGTAACCGCCCACGCGTTCGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTTGGAAACTGGCTTATTCCTCTTATGATTGGTGCCCCAGACATGGCGTTCCCTCGAATGAATAATATGAGCTTTTGACTTCTTCCCCCATCCTTCCTTCTTCTTCTAGCATCCTCAGGAGTAGAGGCCGGGGCCGGAACGGGGTGGACTGTTTACCCGCCTCTGTCAGGCAACCTGGCGCACGCAGGGGCATCCGTTGACTTAACAATCTTTTCTCTACATTTGGCAGGAATTTCCTCAATCCTTGGGGCTATCAATTTCATCACAACGATTCTCAATATGAAGCCCCCGGCCATTTCACAATACCAAACTCCTTTATTTGTTTGAGCAGTACTAATTACAGCAGTCCTTCTTCTTCTCTCTCTGCCAGTTCTTGCCGCTGGGATTACAATGCTACTAACAGATCGGAACTTGAATACTACCTTCTTTGACCCTGCGGGAGGGGGGGACCCCATTCTTTACCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Amblygobius phalaena

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Amblygobius phalaena

Amblygobius phalaena is a Goby from the Pacific Ocean. It occasionally makes its way into the aquarium trade. It grows to a size of 15 cm in length.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!