Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Solitary or in pairs (Ref. 90102). Adults inhabit coastal reefs and lagoons on sand and rubble margins of algal reefs and sometimes near seagrass beds (Ref. 48637). Feed by sifting mouthfuls of sand and expelling it through the gills, to capture small invertebrates, organic matter, and large quantities of algae. Monogamous (Ref. 52884). Spawning is synchronous with semilunar periods (Ref. 84980). Eggs are deposited in burrows which are tended by the male parent (Ref. 55919, 84980). Minimum depth reported from Ref. 27115. Also Ref. 58652.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Pacific Ocean: Philippines to the Society Islands, north to Ryukyu Islands, south to southern Australia (including Lord Howe Island) and Rapa Island; throughout Micronesia. Replaced by Amblygobius albimaculatus in the Red Sea and Amblygobius semicinctus in the western Indian Ocean (Ref. 37816).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 13 - 15; Analspines: 1; Analsoft rays: 14
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 150 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

15.0 cm TL (male/unsexed; (Ref. 9710))
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Characterized by overall greenish brown body color with five dark brown to blackish bars; presence of pale edged dark stripe through eye and another across cheek; head with white streaks; small white spots in 3-4 horizontal rows on body; first dorsal fin with black spot and another on upper caudal fin base; prolonged third and fourth dorsal spines as short filaments, first dorsal spine longer than second; rounded caudal fin; longitudinal scale series 50-55; ctenoid scales; cycloid scales on nape, abdomen, and breast; predorsal scales extending to interorbital space; scales dorsally on opercle, absent on cheek; depth of body 3.4-4.6 in SL (Ref. 90102).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 2 - 20 m (Ref. 1602), usually 2 - 20 m (Ref. 27115)
  • Baensch, H.A. and H. Debelius 1997 Meerwasser atlas. Mergus Verlag GmbH, Postfach 86, 49302, Melle, Germany. 1216 p. 3rd edition. (Ref. 27115)
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 126 specimens in 1 taxon.
Water temperature and chemistry ranges based on 97 samples.

Environmental ranges
  Depth range (m): 0.15 - 30
  Temperature range (°C): 22.496 - 29.325
  Nitrate (umol/L): 0.043 - 1.204
  Salinity (PPS): 32.183 - 35.837
  Oxygen (ml/l): 4.388 - 5.079
  Phosphate (umol/l): 0.055 - 0.441
  Silicate (umol/l): 0.983 - 15.721

Graphical representation

Depth range (m): 0.15 - 30

Temperature range (°C): 22.496 - 29.325

Nitrate (umol/L): 0.043 - 1.204

Salinity (PPS): 32.183 - 35.837

Oxygen (ml/l): 4.388 - 5.079

Phosphate (umol/l): 0.055 - 0.441

Silicate (umol/l): 0.983 - 15.721
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 20m.
From 2 to 20 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits sandy or rubble areas of subtidal reef flats and lagoons and constructs a burrow under a rock or rubble. Feeds by sifting mouthfuls of sand and expelling it through the gills, to capture small invertebrates, organic matter, and large quantities of algae. Feeds on small invertebrates, algae and organic matter (Ref. 1602).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Are monogamous. Although a few pairs changed partners, most pairs remained together over successive rounds of spawnings according to a study (Ref. 84980). Spawning cycle is semilunar. Males construct burrows where the eggs are deposited. Only the males guard the burrows, occassionaly fanning the eggs to provide oxygenated sea water to the burrow. They do this about 41% of the time at the expense of feeding. Egg guarding lasts for 3-4 days after which the eggs hatch in time for the full or new moon phases (Ref. 84980). Parental care shifted from male to female in a study where the male parent was removed from the burrow which according to the study could be attributed to the spatial closeness of the parents and no requirement of special structures for guarding the offsprings (Ref. ).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Amblygobius phalaena

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTCTACCTTGTATTCGGTGCCTGGGCCGGGATGGTAGGCACGGCACTAAGCCTTCTGATCCGGGCCGAACTTAGTCAACCTGGCGCATTACTAGGCGATGACCAAATTTACAATGTAATCGTAACCGCCCACGCGTTCGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTTGGAAACTGGCTTATTCCTCTTATGATTGGTGCCCCAGACATGGCGTTCCCTCGAATGAATAATATGAGCTTTTGACTTCTTCCCCCATCCTTCCTTCTTCTTCTAGCATCCTCAGGAGTAGAGGCCGGGGCCGGAACGGGGTGGACTGTTTACCCGCCTCTGTCAGGCAACCTGGCGCACGCAGGGGCATCCGTTGACTTAACAATCTTTTCTCTACATTTGGCAGGAATTTCCTCAATCCTTGGGGCTATCAATTTCATCACAACGATTCTCAATATGAAGCCCCCGGCCATTTCACAATACCAAACTCCTTTATTTGTTTGAGCAGTACTAATTACAGCAGTCCTTCTTCTTCTCTCTCTGCCAGTTCTTGCCGCTGGGATTACAATGCTACTAACAGATCGGAACTTGAATACTACCTTCTTTGACCCTGCGGGAGGGGGGGACCCCATTCTTTACCAACACCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Amblygobius phalaena

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
  • Burgess, W.E., H.R. Axelrod and R.E. Hunziker III 1990 Dr. Burgess's atlas of marine aquarium fishes. T.F.H. Publications, Inc., Neptune City, New Jersey. 768 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Amblygobius phalaena

Amblygobius phalaena, the White-barred goby, is a species of goby native to tropical reefs of the western Pacific Ocean and through the central Indo-Pacific area at depths of from 2 to 20 metres (6.6 to 66 ft). This species feeds by taking in mouthfuls of sand and sifting out algae, invertebrates and other organic matter. It can reach a length of 15 centimetres (5.9 in) TL. It is also of minor importance to local commercial fisheries and can also be found in the aquarium trade.[1]

References[edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Amblygobius phalaena" in FishBase. April 2013 version.



Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!