Overview
Comprehensive Description
Biology
Adults inhabit coastal reefs and lagoons on sand and rubble margins of algal reefs and sometimes near seagrass beds (Ref. 48637). Feed by sifting mouthfuls of sand and expelling it through the gills, to capture small invertebrates, organic matter, and large quantities of algae. Monogamous (Ref. 52884). Spawning is synchronous with semilunar periods (Ref. 84980). Eggs are deposited in burrows which are tended by the male parent (Ref. 55919, 84980). Minimum depth reported from Ref. 27115. Also Ref. 58652.
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Trusted
Distribution
Gazi Bay
-
Huxham, M., Kimani, E. & Augley, J. 2008. The Fish Community of an East African Mangrove: Effects of Turbidity and Distance from the Sea. Western Indian Ocean Journal of Marine Science, 7, 57-67.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=166307
Trusted
Pacific Ocean: Philippines to the Society Islands, north to Ryukyu Islands, south to southern Australia (including Lord Howe Island) and Rapa Island; throughout Micronesia. Replaced by Amblygobius albimaculatus in the Red Sea and Amblygobius semicinctus in the western Indian Ocean (Ref. 37816).
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Trusted
Physical Description
Morphology
Dorsal spines (total): 7; Dorsal soft rays (total): 14; Analspines: 1; Analsoft rays: 14
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Trusted
Size
Max. size
15.0 cm TL (male/unsexed; (Ref. 9710))
-
Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
http://www.fishbase.org/references/FBRefSummary.php?id=9710&speccode=13770
Trusted
Ecology
Habitat
Environment
reef-associated; marine; depth range 2 - 20 m (Ref. 1602), usually 2 - 20 m (Ref. 27115)
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
-
Baensch, H.A. and H. Debelius 1997 Meerwasser atlas. Mergus Verlag GmbH, Postfach 86, 49302, Melle, Germany. 1216 p. 3rd edition. (Ref. 27115)
http://www.fishbase.org/references/FBRefSummary.php?id=27115&speccode=4306
Trusted
Depth range based on 126 specimens in 1 taxon.
Water temperature and chemistry ranges based on 97 samples.
Environmental ranges
Depth range (m): 0.15 - 30
Temperature range (°C): 22.496 - 29.325
Nitrate (umol/L): 0.043 - 1.204
Salinity (PPS): 32.183 - 35.837
Oxygen (ml/l): 4.388 - 5.079
Phosphate (umol/l): 0.055 - 0.441
Silicate (umol/l): 0.983 - 15.721
Graphical representation
Depth range (m): 0.15 - 30
Temperature range (°C): 22.496 - 29.325
Nitrate (umol/L): 0.043 - 1.204
Salinity (PPS): 32.183 - 35.837
Oxygen (ml/l): 4.388 - 5.079
Phosphate (umol/l): 0.055 - 0.441
Silicate (umol/l): 0.983 - 15.721
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 97 samples.
Environmental ranges
Depth range (m): 0.15 - 30
Temperature range (°C): 22.496 - 29.325
Nitrate (umol/L): 0.043 - 1.204
Salinity (PPS): 32.183 - 35.837
Oxygen (ml/l): 4.388 - 5.079
Phosphate (umol/l): 0.055 - 0.441
Silicate (umol/l): 0.983 - 15.721
Graphical representation
Depth range (m): 0.15 - 30
Temperature range (°C): 22.496 - 29.325
Nitrate (umol/L): 0.043 - 1.204
Salinity (PPS): 32.183 - 35.837
Oxygen (ml/l): 4.388 - 5.079
Phosphate (umol/l): 0.055 - 0.441
Silicate (umol/l): 0.983 - 15.721
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Depth: 2 - 20m.
From 2 to 20 meters.
Habitat: reef-associated.
From 2 to 20 meters.
Habitat: reef-associated.
Trusted
Trophic Strategy
Inhabits sandy or rubble areas of subtidal reef flats and lagoons and constructs a burrow under a rock or rubble. Feeds by sifting mouthfuls of sand and expelling it through the gills, to capture small invertebrates, organic matter, and large quantities of algae. Feeds on small invertebrates, algae and organic matter (Ref. 1602).
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Trusted
Life History and Behavior
Life Cycle
Are monogamous. Although a few pairs changed partners, most pairs remained together over successive rounds of spawnings according to a study (Ref. 84980). Spawning cycle is semilunar. Males construct burrows where the eggs are deposited. Only the males guard the burrows, occassionaly fanning the eggs to provide oxygenated sea water to the burrow. They do this about 41% of the time at the expense of feeding. Egg guarding lasts for 3-4 days after which the eggs hatch in time for the full or new moon phases (Ref. 84980). Parental care shifted from male to female in a study where the male parent was removed from the burrow which according to the study could be attributed to the spatial closeness of the parents and no requirement of special structures for guarding the offsprings (Ref. ).
-
Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
http://www.fishbase.org/references/FBRefSummary.php?id=205&speccode=1256
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Amblygobius phalaena
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 3 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 3 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
ACCCTCTACCTTGTATTCGGTGCCTGGGCCGGGATGGTAGGCACGGCACTAAGCCTTCTGATCCGGGCCGAACTTAGTCAACCTGGCGCATTACTAGGCGATGACCAAATTTACAATGTAATCGTAACCGCCCACGCGTTCGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTTGGAAACTGGCTTATTCCTCTTATGATTGGTGCCCCAGACATGGCGTTCCCTCGAATGAATAATATGAGCTTTTGACTTCTTCCCCCATCCTTCCTTCTTCTTCTAGCATCCTCAGGAGTAGAGGCCGGGGCCGGAACGGGGTGGACTGTTTACCCGCCTCTGTCAGGCAACCTGGCGCACGCAGGGGCATCCGTTGACTTAACAATCTTTTCTCTACATTTGGCAGGAATTTCCTCAATCCTTGGGGCTATCAATTTCATCACAACGATTCTCAATATGAAGCCCCCGGCCATTTCACAATACCAAACTCCTTTATTTGTTTGAGCAGTACTAATTACAGCAGTCCTTCTTCTTCTCTCTCTGCCAGTTCTTGCCGCTGGGATTACAATGCTACTAACAGATCGGAACTTGAATACTACCTTCTTTGACCCTGCGGGAGGGGGGGACCCCATTCTTTACCAACACCTC
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Amblygobius phalaena
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 16
Species With Barcodes: 1
Public Records: 3
Specimens with Barcodes: 16
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
fisheries: minor commercial; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
-
Burgess, W.E., H.R. Axelrod and R.E. Hunziker III 1990 Dr. Burgess's atlas of marine aquarium fishes. T.F.H. Publications, Inc., Neptune City, New Jersey. 768 p.
http://www.fishbase.org/references/FBRefSummary.php?id=9210
Trusted
Wikipedia
Amblygobius phalaena
Amblygobius phalaena is a Goby from the Pacific Ocean. It occasionally makes its way into the aquarium trade. It grows to a size of 15 cm in length.
References
- Froese, Rainer, and Daniel Pauly, eds. (2008). "Amblygobius phalaena" in FishBase. December 2008 version.
| This Gobiidae-related article is a stub. You can help Wikipedia by expanding it. |
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!



