Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Adults occur in clear lagoon and seaward reefs from the lower surge zone to a depth of 30 m (Ref. 1602). Usually in areas with mixed rubble, coral, or rock and sand (Ref. 9710). Usually solitary among large corals. Small juveniles swim with their head down, keeping dorsal and anal fins erected, and may seem like the face of a larger fish when viewed from side on by a predator (Ref. 48636). Oviparous, distinct pairing during breeding (Ref. 205). Occasionally seen in fish markets and aquarium trade.
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This primarily tropical species is widely distributed throughout much of the Indo-Pacific region, from the Red Sea (Jordan) and East Africa in the west to the Tuamotu Islands and Rapa (French Polynesia) in the east, and from the Ryukyu Islands (southern Japan) in the north to the Great Barrier Reef in the south (Lieske and Myers 1994).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Madagascar and Mascarenes east to Marshall Islands and Pitcairn, north to Ryukyu Islands, south to Western Australia, Chesterfield Islands and Rapa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Red Sea to the Tuamoto Islands, north to Ryukyu Islands, south to Rapa.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 12; Analspines: 3; Analsoft rays: 11 - 13
  • Randall, J.E. 1972 A revision of the labrid fish genus Anampses. Micronesica 8(1-2):151-190. (Ref. 2677)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 180 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

18.0 cm TL (male/unsexed; (Ref. 30573))
  • Sommer, C., W. Schneider and J.-M. Poutiers 1996 FAO species identification field guide for fishery purposes. The living marine resources of Somalia. FAO, Rome. 376 p. (Ref. 30573)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Occurs in clear lagoon and seaward reefs from the lower surge zone to a depth of 30 m (Ref. 1602). Occasionally seen in fish markets and aquarium trade.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Body brown, shading to yellow on abdomen, thorax and lower head, and to reddish posteriorly; reddish lips; posterior of operculum with a large black spot, a green spot above and adjacent to this, and above this is a red spot. Pectoral base with a dark brown bar. Dorsal spines pungent.
  • Randall, J.E. 1972 A revision of the labrid fish genus Anampses. Micronesica 8(1-2):151-190. (Ref. 2677)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs in insular and coastal waters primarily around coral reefs, and particularly in clear lagoon and seaward reef areas over mixed living coral, coral rubble and sand habitats, from the lower surge zone down to 30 m (Myers 1991, Lieske and Myers 1994).

It is carnivorous, feeding mainly on benthic macro-invertebrates (Masuda and Allen 1993, Lieske and Myers 1994). It shows some sexual colour dimorphism. It is not known whether this species is a protogynous hermaphrodite like most other members of the genus.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 5 - 30m.
From 5 to 30 meters.

Habitat: reef-associated. Occurs in clear lagoon and seaward reefs from the lower surge zone to a depth of 30 m (Ref. 1602). Usually in areas with mixed rubble, coral, or rock and sand (Ref. 9710). Occasionally seen in fish markets and aquarium trade. Distribution - Indo-Pacific including Red Sea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 5 - 30 m (Ref. 9823)
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 8 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 3.5 - 33
  Temperature range (°C): 25.819 - 28.798
  Nitrate (umol/L): 0.019 - 0.498
  Salinity (PPS): 34.192 - 35.347
  Oxygen (ml/l): 4.529 - 4.701
  Phosphate (umol/l): 0.143 - 0.284
  Silicate (umol/l): 0.897 - 4.892

Graphical representation

Depth range (m): 3.5 - 33

Temperature range (°C): 25.819 - 28.798

Nitrate (umol/L): 0.019 - 0.498

Salinity (PPS): 34.192 - 35.347

Oxygen (ml/l): 4.529 - 4.701

Phosphate (umol/l): 0.143 - 0.284

Silicate (umol/l): 0.897 - 4.892
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in clear lagoon and seaward reefs from the lower surge zone to a depth of 30 m (Ref. 1602). Usually in areas with mixed rubble, coral, or rock and sand (Ref. 9710), and in coral reefs (Ref. 9137).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anampses twistii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTATTTAGTATTCGGCGCCTGAGCCGGGATGGTAGGCACAGCCTTAAGCTTACTCATTCGAGCTGAACTAAGCCAGCCCGGTGCTCTCCTCGGAGACGACCAAATCTACAATGTTATCGTTACAGCCCATGCATTCGTTATAATCTTCTTTATAGTAATGCCAATTATGATTGGCGGATTCGGGAATTGACTTATCCCCCTAATAATCGGAGCACCCGACATAGCCTTCCCTCGAATGAACAACATGAGCTTTTGACTCCTACCCCCATCTTTCTTACTTCTTCTTGCTTCTTCTGGTGTAGAAGCTGGGGCCGGGACTGGTTGAACAGTTTACCCCCCTCTAGCGGGAAATCTTGCCCACGCAGGTGCATCTGTTGACTTAACCATCTTTTCCCTACATTTAGCTGGCATTTCTTCAATCCTGGGTGCCATCAACTTTATTACAACCATTATTAACATAAAACCTCCTGCCATCTCCCAATACCAAACTCCCCTATTTGTGTGAGCCGTACTAATTACAGCAGTACTTCTTCTCCTTTCACTACCCGTTCTAGCGGCTGGAATTACAATACTTCTAACAGATCGAAATCTAAACACCACTTTCTTCGACCCTGCCGGAGGTGGAGATCCTATTCTTTATCAACACCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anampses twistii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Pollard, D., Cabanban, A. & Yeeting, B.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This species has a very wide distribution in the tropical waters of the Indian and Pacific Oceans. Although there is no evidence for any population declines, it is taken in the marine aquarium fish trade, and occasionally also for food. It is, however, well protected in Marine Protected Areas within its area of distribution. This species is therefore listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This is apparently a relatively common species throughout most of its broad range. There is no other population information available for this species.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no known major threats to this species, though specimens are occasionally captured live for the marine aquarium fish trade, and others are occassionally sold in local fish markets for food.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific conservation measures in place for this species, however its distribution overlaps several marine reserves in parts of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
  • Burgess, W.E., H.R. Axelrod and R.E. Hunziker III 1990 Dr. Burgess's atlas of marine aquarium fishes. T.F.H. Publications, Inc., Neptune City, New Jersey. 768 p.
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Anampses twistii

The yellow-breasted wrasse, Anampses twistii, is a species of wrasse native to the tropical waters of the Indo-Pacific area from the Red Sea to the Tuamoto Islands. It is found in lagoons and on reefs at depths of 5 to 30 m (16 to 98 ft). It can reach a length of 18 cm (7.1 in). It is of minor importance to local commercial fisheries and can be found in the aquarium trade.[2]

References[edit]

  1. ^ Pollard, D., Cabanban, A. & Yeeting, B. 2010. Anampses twistii. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 30 August 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Anampses twistii" in FishBase. August 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!