Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Found over sandy or muddy bottoms of coastal inshore waters (Ref. 35849, 47581). Feeds mainly on small fishes, crustaceans and polychaetes (Ref. 3424). Forms schools (Ref. 47581). Larger specimens marketed fresh or dried-salted but most of the catch made into fishmeal or discarded (Ref. 47581).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The Smalltoothed Ponyfish (Gazza achlamys) has been recorded in the Indo-Malayan-region, from Sumatra to Java, Flores, Sabah, Ambon, Lombok and the Philippines, and the eastern half of New Guinea to the Solomon Islands. In the North Pacific is reported from the southern Marianas, Pohnpei, Taiwan Province of China, and Okinawa in Japan. In the Indian Ocean, it is found off Sri Lanka and southern India. There have also been reports of this species off the east coast of Australia (FAO 2001) and in the waters around Japan (Kimura et al. 2006), however this needs confirmation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: Sri Lanka and from Taiwan to Indonesia and Papua New Guinea. Records from eastern Australia needs confirmation (Ref. 47581).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8; Dorsal soft rays (total): 16; Analspines: 3; Analsoft rays: 14; Vertebrae: 24
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 150 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

17.0 cm TL (male/unsexed; (Ref. 47581))
  • Woodland, D.J., S. Premcharoen and A.S. Cabanban 2001 Leiognathidae. Slipmouths (ponyfishes). p. 2792-2823. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Volume 5. Bony fishes part 3 (Menidae to Pomacentridae). Rome, FAO. pp. 2791-3380. (Ref. 47581)   http://www.fishbase.org/references/FBRefSummary.php?id=47581&speccode=5797 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Membrane of spinous dorsal fin black at its distal portion (Ref. 47581).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Smalltoothed Ponyfish can be found on sandy or muddy substrates in brackish and coastal, inshore waters to a depth of 20 m. This schooling species, feeds mainly on small fishes, crustaceans and polychaetes.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; brackish; marine; depth range ? - 20 m (Ref. 35849)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 2 - 2
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits coastal waters down to depths of about 40 m, predominantly near the bottom. Feeds mainly on small fishes, crustaceans and polychaetes.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gazza achlamys

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTATTTGGTGCTTGAGCCGGCATAGTCGGAACAGCCCTAAGCCTACTCATCCGAGCAGAATTGAGCCAACCCGGCGCTCTCCTAGGGGAT---GACCATATCTATAATGTTATCGTCACTGCCCATGCATTTGTAATAATTTTTTTTATAGTTATACCTATCATAATTGGCGGCTTTGGCAACTGACTCATTCCACTAATAATTGGGGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGTTTTTGACTCCTCCCCCCATCATTCCTGCTCCTCTTAGCATCTTCCGGTATCGAAGCCGGCGCAGGCACGGGATGAACCGTCTACCCCCCCTTGGCAGGGAACCTTGCCCACGCAGGTGCCTCTGTTGATTTAACAATTTTCTCACTTCATCTAGCCGGGATCTCCTCAATTTTAGGGGCTATTAACTTCATTACAACAATTATTAACATAAAACCCCCAGCCATTTCACAATTCCAAACCCCCCTATTCGTCTGGGCCGTTCTTATTACAGCCGTCCTTCTTCTCTTATCCCTACCAGTTCTCGCAGCTGGCATCACAATGCTCCTGACAGATCGAAACCTAAACACCACTTTCTTCGACCCAGCAGGAGGCGGAGACCCAATTCTATAC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gazza achlamys

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Gazza cf. achlamys

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gazza cf. achlamys

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Kimura, S.

Reviewer/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P. & Smith, J. and Livingston, F.

Justification
Gazza achlamys has been assessed as Least Concern. Although this species is of commercial importance to fisheries, this threat is not known throughout its entire broad distribution and it not thought to be causing any significant population declines at present. Monitoring of the harvest levels and extent of harvest of this species is needed to ensure this threat does not increase in the future. Further research is also needed on the distribution of this species in order to confirm its true range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is no population information for the Smalltoothed Ponyfish.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The Smalltoothed Ponyfish is of minor importance to commercial fisheries. This species is caught throughout the year, mainly with bottom trawls; also in bag nets and shore seines. Larger specimens may be marketed fresh or dried-salted, but catches are mostly converted to fishmeal or dumped at sea. There is no indication that this species is undergoing a significant population decline as a result of harvesting.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for the Smalltoothed Ponyfish, however its distribution may coincide with a number of marine protected areas.

Further research and monitoring of the harvest levels and population trends of this species is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
  • Woodland, D.J., S. Premcharoen and A.S. Cabanban 2001 Leiognathidae. Slipmouths (ponyfishes). p. 2792-2823. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Volume 5. Bony fishes part 3 (Menidae to Pomacentridae). Rome, FAO. pp. 2791-3380. (Ref. 47581)   http://www.fishbase.org/references/FBRefSummary.php?id=47581&speccode=5797 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!