Overview

Brief Summary

Members of the deep-sea and oceanic fish family Oreosomatidae, to which the Ox-eyed Oreo (Oreosoma atlanticum) belongs, are deep bodied and laterally compressed, with large heads and eyes and a protrusible mouth. Oreos are often found at depths below 500 meters over the continental slope in most temperate (and some tropical and subtropical) waters, perhaps especially in the southern hemisphere. Many oreo species are of significant commercial value (although O. atlanticum is not due to its small size), especially in the southern hemisphere around Australia and New Zealand where deep-sea trawling is common. (Eschmeyer et al. 1983; Lowry et al. 1994). Adult Ox-eyed Oreos have a very large eye (eye diameter is ~50-60% of head length) and a prominent horizontal ridge on the operculum (gill cover) (Lowry et al. 1996).

The Ox-eyed Oreo is found in the southeastern Atlantic and western Indian Oceans, occurring around South Africa between 30° and 35° S, and in the southwestern Pacific off Australia (including western and southern Australia) and New Zealand. Depth range is 220 to 1550 m. (Karrer 1986, cited in Froese and Pauly 2012; Paulin et al.1989, cited in Froese and Pauly 2012).

Ox-eyed Oreos have 6-8 dorsal spines (total), 29-31 dorsal soft rays (total), 2-3 anal spines, and 28-31 anal soft rays. Pre-juveniles are blackish violet with greenish silvery cones and irregular blotches on the back (prominent cone-like outgrowths are a distinctive feature of juvenile Oreosoma, although some other juvenile oreosomatids have similar but less dramatic protuberances on their bodies). Maximum total adult length is around 21 cm. (Karrer 1986, cited in Froese and Pauly 2012)

  • Eschmeyer, W.N. and E.S. Herald. 1983. A Field Guide to Pacific Coast Fishes of North America. Houghton Mifflin, Boston.
  • Froese, R. and D. Pauly. Editors. 2012. FishBase. World Wide Web electronic publication. www.fishbase.org, version 02/2012. Oreosoma atlanticum on FishBase
  • Karrer, C. 1986. Oreosomatidae. pp. 438-440 in Smiths' Sea Fishes (M.M. Smith and P.C. Heemstra, eds.). Springer-Verlag, Berlin.
  • Lowry, P. S., Elliott, N. G., Yearsley, G. K., and R.D. Ward. 1996. Genetic variation and phylogenetic relationships of seven oreo species (Teleostei, Oreosomatidae) inferred from allozyme analysis. Fishery Bulletin 94(4): 692 -706.
  • Paulin, C.D, A. Stewart, C.D. Roberts, and P. J. McMillan. 1989. New Zealand fish: a complete guide. National Museum of New Zealand Miscellaneous Series No. 19.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Found on the continental slope. Benthic species (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Southeast Atlantic and Western Indian Ocean: around South Africa between 30° and 35°S. Southwest Pacific: Australia (including western and southern Australia) and New Zealand (Ref. 5755).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southern circumglobal (except South America).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 6 - 8; Dorsal soft rays (total): 29 - 31; Anal spines: 2 - 3; Analsoft rays: 28 - 31
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 210 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

21.0 cm TL (male/unsexed; (Ref. 6548))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Prejuveniles blackish violet in color; cones and irregular blotches on back greenish silvery (Ref. 6548).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathydemersal; marine; depth range 220 - 1550 m (Ref. 6548)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 61 specimens in 1 taxon.
Water temperature and chemistry ranges based on 37 samples.

Environmental ranges
  Depth range (m): 112 - 1122.5
  Temperature range (°C): 3.098 - 10.465
  Nitrate (umol/L): 18.732 - 34.042
  Salinity (PPS): 34.336 - 34.980
  Oxygen (ml/l): 4.043 - 5.012
  Phosphate (umol/l): 1.183 - 2.370
  Silicate (umol/l): 11.458 - 53.400

Graphical representation

Depth range (m): 112 - 1122.5

Temperature range (°C): 3.098 - 10.465

Nitrate (umol/L): 18.732 - 34.042

Salinity (PPS): 34.336 - 34.980

Oxygen (ml/l): 4.043 - 5.012

Phosphate (umol/l): 1.183 - 2.370

Silicate (umol/l): 11.458 - 53.400
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 220 - 1550m.
From 220 to 1550 meters.

Habitat: bathydemersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oreosoma atlanticum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTAGTATTTGGTGCCTGAGCCGGCATGGTCGGAACAGCCCTAAGCCTCCTTATTCGAGCTGAGCTCAGCCAGCCGGGGGCACTACTTGGGGATGACCAAATTTATAATGTAATCGTCACAGCCCATGCGTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGGGGCTTTGGAAATTGACTTGTCCCACTAATGATTGGAGCCCCAGACATGGCCTTCCCCCGAATAAATAACATGAGCTTCTGGCTTCTTCCCCCTTCCTTCCTCCTCCTCCTCGCCTCATCAGGGGTTGAAGCCGGAGCTGGGACAGGATGAACAGTCTACCCTCCCCTAGCAGGCAATTTGGCCCACGCAGGAGCTTCCGTAGATTTAACCATTTTCTCACTTCACTTAGCAGGTATCTCTTCAATTCTAGGGGCCATTAATTTCATCACAACAATTATTAATATAAAACCCCCCGCCATCTCACAATATCAAACCCCCCTATTTGTGTGGGCTGTATTAATTACAGCAGTTCTTCTCCTCCTCTCACTCCCAGTTCTAGCAGCTGGAATTACAATACTTCTTACAGACCGCAATCTAAACACCTCTTTCTTCGACCCAGCCGGAGGAGGAGACCCTATTTTGTACCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oreosoma atlanticum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Oreosoma atlanticum

Oreosoma atlanticum, also known as the Ox-eyed oreo, is a species of oreo found in oceanic deep waters at depths of from 220 to 1,550 metres (720 to 5,090 ft). This species grows to a length of 21 centimetres (8.3 in) TL. This species is the only known member of its genus.

References


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!