Overview

Comprehensive Description

Biology

Found on the continental slope. Benthic species (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Southeast Atlantic and Western Indian Ocean: around South Africa between 30° and 35°S. Southwest Pacific: Australia (including western and southern Australia) and New Zealand (Ref. 5755).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southern circumglobal (except South America).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 6 - 8; Dorsal soft rays (total): 29 - 31; Anal spines: 2 - 3; Analsoft rays: 28 - 31
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 210 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

21.0 cm TL (male/unsexed; (Ref. 6548))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Prejuveniles blackish violet in color; cones and irregular blotches on back greenish silvery (Ref. 6548).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathydemersal; marine; depth range 220 - 1550 m (Ref. 6548)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 61 specimens in 1 taxon.
Water temperature and chemistry ranges based on 37 samples.

Environmental ranges
  Depth range (m): 112 - 1122.5
  Temperature range (°C): 3.098 - 10.465
  Nitrate (umol/L): 18.732 - 34.042
  Salinity (PPS): 34.336 - 34.980
  Oxygen (ml/l): 4.043 - 5.012
  Phosphate (umol/l): 1.183 - 2.370
  Silicate (umol/l): 11.458 - 53.400

Graphical representation

Depth range (m): 112 - 1122.5

Temperature range (°C): 3.098 - 10.465

Nitrate (umol/L): 18.732 - 34.042

Salinity (PPS): 34.336 - 34.980

Oxygen (ml/l): 4.043 - 5.012

Phosphate (umol/l): 1.183 - 2.370

Silicate (umol/l): 11.458 - 53.400
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 220 - 1550m.
From 220 to 1550 meters.

Habitat: bathydemersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oreosoma atlanticum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTAGTATTTGGTGCCTGAGCCGGCATGGTCGGAACAGCCCTAAGCCTCCTTATTCGAGCTGAGCTCAGCCAGCCGGGGGCACTACTTGGGGATGACCAAATTTATAATGTAATCGTCACAGCCCATGCGTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGGGGCTTTGGAAATTGACTTGTCCCACTAATGATTGGAGCCCCAGACATGGCCTTCCCCCGAATAAATAACATGAGCTTCTGGCTTCTTCCCCCTTCCTTCCTCCTCCTCCTCGCCTCATCAGGGGTTGAAGCCGGAGCTGGGACAGGATGAACAGTCTACCCTCCCCTAGCAGGCAATTTGGCCCACGCAGGAGCTTCCGTAGATTTAACCATTTTCTCACTTCACTTAGCAGGTATCTCTTCAATTCTAGGGGCCATTAATTTCATCACAACAATTATTAATATAAAACCCCCCGCCATCTCACAATATCAAACCCCCCTATTTGTGTGGGCTGTATTAATTACAGCAGTTCTTCTCCTCCTCTCACTCCCAGTTCTAGCAGCTGGAATTACAATACTTCTTACAGACCGCAATCTAAACACCTCTTTCTTCGACCCAGCCGGAGGAGGAGACCCTATTTTGTACCAACACTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oreosoma atlanticum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Oreosoma atlanticum

Oreosoma atlanticum, also known as the Ox-eyed oreo, is a species of oreo found in oceanic deep waters at depths of from 220 to 1,550 metres (720 to 5,090 ft). This species grows to a length of 21 centimetres (8.3 in) TL. This species is the only known member of its genus.

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!