Overview

Comprehensive Description

Biology

Is very active and is always moving. Frequently found in well oxygenated waters (Ref. 12225). Occurs mainly near the surface and at times jumps out of the water. Feeds on worms, insect larvae and small fishes (Ref. 7020).
  • Lima, F.C.T., L.R. Malabarba, P.A. Buckup, J.F. Pezzi da Silva, R.P. Vari, A. Harold, R. Benine, O.T. Oyakawa, C.S. Pavanelli, N.A. Menezes, C.A.S. Lucena, M.C.S.L. Malabarba, Z.M.S. Lucena, R.E. Reis, F. Langeani, C. Moreira et al. … 2003 Genera Incertae Sedis in Characidae. p. 106-168. In R.E. Reis, S.O. Kullander and C.J. Ferraris, Jr. (eds.) Checklist of the Freshwater Fishes of South and Central America. Porto Alegre: EDIPUCRS, Brasil. (Ref. 38376)   http://www.fishbase.org/references/FBRefSummary.php?id=38376&speccode=10622 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

South America: Negro and Orinoco River basins and coastal rivers in Guyana, Suriname, and French Guiana.
  • Lima, F.C.T., L.R. Malabarba, P.A. Buckup, J.F. Pezzi da Silva, R.P. Vari, A. Harold, R. Benine, O.T. Oyakawa, C.S. Pavanelli, N.A. Menezes, C.A.S. Lucena, M.C.S.L. Malabarba, Z.M.S. Lucena, R.E. Reis, F. Langeani, C. Moreira et al. … 2003 Genera Incertae Sedis in Characidae. p. 106-168. In R.E. Reis, S.O. Kullander and C.J. Ferraris, Jr. (eds.) Checklist of the Freshwater Fishes of South and Central America. Porto Alegre: EDIPUCRS, Brasil. (Ref. 38376)   http://www.fishbase.org/references/FBRefSummary.php?id=38376&speccode=10622 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Negro and Orinoco River basins, and coastal rivers of northern South America: Brazil, Colombia, French Guiana, Guyana, Suriname and Venezuela.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 240 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

24.5 cm SL (male/unsexed; (Ref. 38376))
  • Lima, F.C.T., L.R. Malabarba, P.A. Buckup, J.F. Pezzi da Silva, R.P. Vari, A. Harold, R. Benine, O.T. Oyakawa, C.S. Pavanelli, N.A. Menezes, C.A.S. Lucena, M.C.S.L. Malabarba, Z.M.S. Lucena, R.E. Reis, F. Langeani, C. Moreira et al. … 2003 Genera Incertae Sedis in Characidae. p. 106-168. In R.E. Reis, S.O. Kullander and C.J. Ferraris, Jr. (eds.) Checklist of the Freshwater Fishes of South and Central America. Porto Alegre: EDIPUCRS, Brasil. (Ref. 38376)   http://www.fishbase.org/references/FBRefSummary.php?id=38376&speccode=10622 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Is very active and is always moving. Frequently found in well oxygenated waters (Ref. 12225). Occurs mainly near the surface and at times jumps out of the water. Feeds on worms, insect larvae, small fishes (Ref. 7020); plants and terrestrial invertebrates (Ref. 76754). Omnivore (Ref. 76754).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Chalceus aff. macrolepidotus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Chalceus macrolepidotus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGCTGATTCTTCTCTACTAACCACAAAGACATTGGCACCCTCTATCTAGTATTTGGTGCCTGAGCCGGGATAGTTGGTACGGCCCTGAGCCTACTAATTCGGGCAGAGCTAAGCCAACCCGGAGCCCTGATAGGCGAT---GATCAGATTTACAACGTTATTGTAACTGCACACGCATTTGTAATAATTTTCTTTATAGTAATGCCAGTTATAATTGGAGGCTTCGGAAACTGACTTGTGCCTCTAATGATTGGTGCCCCCGATATGGCTTTTCCCCGAATAAACAATATGAGCTTTTGACTCCTTCCCCCTTCTTTCCTACTGCTCTTGGCTTCTTCAGGGGTAGAAGCAGGAGCTGGGACAGGTTGGACCGTCTACCCACCACTCGCCGGCAACCTAGCCCACGCAGGGGCTTCTGTCGACCTAACCATTTTCTCCCTTCATCTTGCCGGGGTGTCCTCTATTCTAGGGGCCATTAACTTTATTACCACAATTATCAACATAAAACCACCAGCCATCTCTCAATACCAAACACCTTTGTTTGTTTGAGCCGTTTTAATTACAGCCGTCCTTCTGCTCCTATCCCTGCCAGTTCTAGCTGCCGGGATTACCATGCTCCTCACAGACCGAAATTTAAATACAACATTCTTCGATCCTGCAGGGGGAGGAGACCCCATCCTCTACCAACATTTATTTTGATTCTTCGGACACCCCGAAGTGTACATTCTAATTTTACCAGGATTTGGAATAATTTCACACATTGTAGCTTACTACTCAGGCAAAAAAGAACCATTCGGCTACATGGGAATAGTCTGAGCCATGATGGCCATCGGCCTCTTAGGCTTTATTGTTTGAGCCCATCACATGTTTACAGTAGGAATAGACGTAGACACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chalceus macrolepidotus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!