Articles on this page are available in 2 other languages: Spanish (1), Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Found on the upper continental slope (Ref. 50610, 75154), over rocky substrata (Ref. 58302).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Nova Scotia to the Caribbean
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The Grey Cutthroat Eel, Synaphobranchus affinis, is found in all oceans. In the eastern Atlantic this species is distributed from Liberia to South Africa, and in the western Atlantic this species is known from Cuba and Trinidad and Tobago. In the Indian Ocean it has been recorded from Madagascar, the Comoros and Reunion. In the Pacific, this species is known from Hawaii, Japan, Australia, Papua New Guinea, New Zealand and Chile.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal, except the northeast Pacific (Ref. 26895). Eastern Atlantic: Liberia to northern Angola (Ref. 5235).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in tropical through temperate seas (including Mascarenes, Hawaiian Islands), except eastern North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continental slope from South Carolina to the Grand Banks; in the east from Cape Verdes; off Morocco; from the Canaries; from the Azores; near Madeira; also from the Faroe-Shetland Channel.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Sulak, K. J. and Y. N. Shcherbachev, 1997; Paxton, J. R., D. F. Hoese, G. R. Allen and J. E. Hanley., 1989.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal soft rays (total): 230
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 600 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

160 cm TL (male/unsexed; (Ref. 26895))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 111cm TL (male/unsexed).
  • Bigelow, H. B. and Schroeder, W. C., 1953; Sulak, K. J. and Y. N. Shcherbachev, 1997; Paxton, J. R., D. F. Hoese, G. R. Allen and J. E. Hanley., 1989.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Dark grey in color (Ref. 3973). Anal rays about 230 (Ref. 3973).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Synaphobranchus affinis
Catalog Number: USNM 51591
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Year Collected: 1902
Locality: Vicinity of Kauai Island: Hanamaulu Warehouse, S. 43 Deg., W. 8.1', Kauai, Hawaii, United States, Hawaiian Islands, Pacific
Depth (m): 1006 to 748
Vessel: Albatross
  • Type: Gilbert, C. H. 1905. Bulletin of the United States Fish Commission. 23 (for 1903): 583, fig. 232.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Synaphobranchus affinis
Catalog Number: USNM 51696
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1902
Locality: Hawaii, United States, Hawaiian Islands, Pacific
Vessel: Albatross
  • Paratype: Gilbert, C. H. 1905. Bulletin of the United States Fish Commission. 23 (for 1903): 583, fig. 232.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found on the upper continental slope.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This bathydemersal species is found on the upper continental slope, at a depth range of 290-2,400 m. This species spends much of its time over rocky substrata.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

benthopelagic; marine; depth range 290 - 2400 m (Ref. 50610), usually 400 - 500 m (Ref. 26999)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 98 specimens in 1 taxon.
Water temperature and chemistry ranges based on 52 samples.

Environmental ranges
  Depth range (m): 104 - 1704.5
  Temperature range (°C): 2.964 - 11.680
  Nitrate (umol/L): 13.010 - 41.984
  Salinity (PPS): 34.346 - 35.701
  Oxygen (ml/l): 1.552 - 6.036
  Phosphate (umol/l): 1.009 - 2.944
  Silicate (umol/l): 8.292 - 133.284

Graphical representation

Depth range (m): 104 - 1704.5

Temperature range (°C): 2.964 - 11.680

Nitrate (umol/L): 13.010 - 41.984

Salinity (PPS): 34.346 - 35.701

Oxygen (ml/l): 1.552 - 6.036

Phosphate (umol/l): 1.009 - 2.944

Silicate (umol/l): 8.292 - 133.284
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 400 - 1100m.
From 400 to 1100 meters.

Habitat: bathydemersal. Found on the upper continental slope.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bathydemersal; marine; depth range 900 - 3000 m. Continental slope.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Sulak, K. J. and Y. N. Shcherbachev, 1997; Paxton, J. R., D. F. Hoese, G. R. Allen and J. E. Hanley., 1989.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Invertebrates (epibenthic copepods and amphipods) and fishes.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Sulak, K. J. and Y. N. Shcherbachev, 1997; Paxton, J. R., D. F. Hoese, G. R. Allen and J. E. Hanley., 1989.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Spawns in summer. Ripe eggs are orange in color, 1 mm in diameter.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Sulak, K. J. and Y. N. Shcherbachev, 1997; Paxton, J. R., D. F. Hoese, G. R. Allen and J. E. Hanley., 1989.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Synaphobranchus affinis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTGTATCTAGTATTTGGTGCTTGAGCTGGCATGGTGGGCACCGCGCTCAGCCTGCTAATCCGAGCCGAGCTTAGCCAGCCCGGAGCCCTACTTGGAGACGACCAAATCTATAATGTTATTGTTACAGCACATGCCTTCGTAATGATCTTCTTTATAGTAATACCCGTGATAATCGGGGGATTTGGCAATTGATTGGTACCCCTAATAATTGGGGCCCCAGATATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTCCTCCCCCCATCATTTCTTCTACTATTAGCCTCGTCTGGGGTAGAAGCTGGTGCAGGAACAGGATGAACAGTTTACCCACCCCTTGCTGGCAACCTGGCCCACGCCGGAGCCTCCGTAGACTTAACCATTTTCTCCCTCCATCTCGCGGGGATCTCATCTATCCTTGGGGCCATTAACTTTATTACTACAATTATTAATATGAAACCCCCTGCCATCTCACAGTACCAAACCCCGCTATTTGTCTGAGCCGTCCTAGTAACAGCAGTCCTTCTACTATTATCCCTACCAGTTCTTGCCGCAGGAATCACTATACTTCTTACTGACCGAAACCTAAATACAACCTTCTTTGACCCGGCGGGGGGAGGGGACCCTATTTTATACCAACA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Synaphobranchus affinis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Smith, D. & Gordon, J.D.M.

Reviewer/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P., Smith, J. & Livingston, F.

Justification
Due to the deepwater nature and circumglobal distribution of this species, Synaphobranchus affinis is unlikely to be impacted by any major threatening process across its range, and consequently an assessment of Least Concern has been made.

The Grey Cutthroat Eel, Synaphobranchus affinis, has been assessed as Least Concern. This species has a circumglobal distribution. There is no directed fishery for this species
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no population information available for this species.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Due to the deepwater nature of this species it is unlikely that it is being impacted by any major threats. There is no directed fishery for this species. This species is not likely to be taken as by-catch in significant quantities as it most often found over rocky substrata at bathyl depths, a habitat that is not favourable for trawling.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place, or that are needed, for the Grey Cutthroat Eel.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Grey cutthroat eel

The grey cutthroat eel, Synaphobranchus affinis, is a cutthroat eel. It is found globally in deep waters.

References

  • Froese, Rainer, and Daniel Pauly, eds. (2011). "Synaphobranchus affinis" in FishBase. June 2011 version.
  • Tony Ayling & Geoffrey Cox, Collins Guide to the Sea Fishes of New Zealand, (William Collins Publishers Ltd, Auckland, New Zealand 1982) ISBN 0-00-216987-8
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!