Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

Biology

Since its discovery in 1976, only 17 sightings have been recorded of this elusive fish (3) and the majority of these have been of dead specimens; either accidentally caught or stranded individuals (5). Consequently, very little is known of their natural ecology and behavioural observations have only been possible from the tagging of one individual for a brief two-day period in 1990 (3). This shark was observed to undergo vertical migrations, spending the day in deep water and ascending to midwater at night; it is likely that this migration is undertaken in response to the movements of prey species such as krill (3). Megamouth sharks are thought to feed by swimming through groups of small prey items with their mouths open; however, no direct observations have yet been achieved (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The megamouth shark is one of the most mysterious and least understood of all the sharks. It was first recorded in 1976 and is so different from other shark lineages that it has been placed in its own family: Megachasmidae (3). Megamouth sharks can reach over 5 metres in length (4); the head is large with a short snout and, as the name would suggest, an extremely large mouth (5). The mouth contains over 50 rows of very small, hooked teeth. The body is tapered with a fleshy appearance; it is a blackish-brown colour above and white below (3). There are two unequal sized dorsal fins and the tail has a longer upper lobe (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Oceanic, possibly occurring in depths between 150 and 1,000 m (Ref. 6871). Epi- and mesopelagic (Ref. 58302). Feeds on planktivorous prey such as euphausiid shrimps, copepods and jellyfish (Ref. 6871). May also eat small midwater fishes. Ovoviviparous (Ref. 50449). Possibly less active than the basking and whale sharks (Ref. 6871). Its feeding habits and habitat suggest that it may be a rare catch in the future. Ovoviviparous, embryos feeding on yolk sac and other ova produced by the mother (Ref. 50449). Males mature by 400 cm (Ref. 6871). A bright white band on the snout just above the upper jaw may play a role in feeding behavior or with recognition of individuals (Ref. 47761). Preyed on by the semi-parasitic cookiecutter shark, Isistius brasiliensis.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is known from only a few specimens but probably it is circumtropical and wide ranging. Known records are from the following areas:

Western Atlantic: Brazil.
Eastern Atlantic: Senegal.
South-eastern Indian Ocean: Western Australia.
Northwest Pacific: Japan, Philippines, Indonesia.
Central Pacific: Hawaiian Islands (Oahu).
Eastern Pacific: USA (southern California).

A coastal and oceanic, epipelagic and neritic species, it has been found in water as shallow as 5m in a bay and 40 m deep on the continental shelf. It has also been recorded offshore in the epipelagic zone at 8?165 m depth in water 348?4,600 m deep and some have been washed ashore (Yano et al. 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pacific Ocean: Japan, Indonesia, Philippines, Hawaii and California, USA. Atlantic Ocean: Brazil and Senegal.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The Megamouth Shark was recently discovered in deep water off of the Hawaiian Islands and near the shores of California, Japan and Western Australia.

Biogeographic Regions: pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pacific, Atlantic and eastern Indian oceans; few records, including Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Megamouth sharks have been reported from the Indian, Pacific and Atlantic Oceans (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Vertebrae: 125
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

The megamouth Shark is five meters long and weighs approximately 750 kilograms. Its body is cylindrical and flabby, its eyes small, and it swims in stiff, slow movements.

Average mass: 750 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 5150 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

549 cm TL (male/unsexed; (Ref. 85838)); 709 cm TL (female)
  • Dulvy, N.K., J.K. Baum, S. Clarke, L.J.V. Compagno, E. Cortés, A. Domingo, S. Fordham, S. Fowler, M.P. Francis, C. Gibson, J. Martínez, J.A. Musick, A. Soldo, J.D. Stevens and S. Valenti 2008 You can swim but you can't hide: the global status and conservation of oceanic pelagic sharks and rays. Aquat. Conserv.: Mar. Freshw. Ecosyst. (Ref. 85838)   http://www.fishbase.org/references/FBRefSummary.php?id=85838&speccode=5909 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body stout, tapering posteriorly (Ref. 6871), tadpole-like with larger head and tapering trunk and tail (Ref. 47786). Snout extremely short but broadly rounded (Ref 43278, 47786). Head huge, blubbery (Ref. 6871). Mouth very broad and terminal on head, with corner extending behind the eyes (Ref. 6871, 43278). Jaws huge, protrusible anteriorly but not greatly distensible laterally (Ref. 43278, 47786), lower jaw extending to snout tip (Ref. 6871). Teeth very small, numerous, hooked (Ref. 43278, 6871, 47787). Gill slits moderately long, not reaching dorsal surface of head (Ref. 6871; 43278), internal gill slits lined with dense rows of papillose gill rakers (Ref. 43278). Eyes semicircular (Ref. 47786), with no nictitating membrane (Ref. 43278, 6871, 47786). Two dorsal fins, relatively low and angular; small anal fin; long, narrow pectoral fins; moderate-sized pelvic fin; caudal fin asymmetrical, non-lunate, with a short and strong ventral lobe; upper pre-caudal pit only; caudal peduncle without keels or ridges (Ref, 6871, 43278).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The only known prey of the Megamouth Shark are epipelagic and mesopelagic euphausiid shrimp, copepods and jellyfish (Yano et al. 1997). The feeding structures of this shark may allow it to feed on other pelagic invertebrates and even small fishes, but so far the stomach contents studied suggest that it primarily targets euphausiid shrimp (Compagno 2001).

Observations made on a live-captured megamouth shark which was later tagged with an acoustic telemetric tag and tracked for two days, suggested it could breathe readily by gill-pumping and was not dependent on constant swimming like other lamnoid sharks. During the tracking period, the shark revealed a pattern of vertical, crepuscular migration in the epipelagic zone. It has been suggested that the Megamouth Shark may follow vertical migrations of euphausiid prey during diel cycles (Compagno 2001).

The mode of reproduction is probably aplacental viviparous with uterine cannabilism or cannibal vivipary suspected in the form of oophagy. A late immature or early adolescent female had two ovaries with many tiny oocytes, while an adult female had numerous larger oocytes. This is similar to the ovaries of other lamnoids.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

pelagic-oceanic; oceanodromous (Ref. 51243); marine; depth range 5 - 600 m (Ref. 58302), usually 120 - 166 m (Ref. 48844)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The megamouth lives in the deep scattering layer of the ocean. It seems to enjoy warmer climates, though it has been discovered in temperate waters.

Aquatic Biomes: benthic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 30 - 165
  Temperature range (°C): 18.190 - 20.614
  Nitrate (umol/L): 1.222 - 15.547
  Salinity (PPS): 35.107 - 35.749
  Oxygen (ml/l): 2.503 - 4.612
  Phosphate (umol/l): 0.162 - 1.059
  Silicate (umol/l): 1.936 - 5.985

Graphical representation

Depth range (m): 30 - 165

Temperature range (°C): 18.190 - 20.614

Nitrate (umol/L): 1.222 - 15.547

Salinity (PPS): 35.107 - 35.749

Oxygen (ml/l): 2.503 - 4.612

Phosphate (umol/l): 0.162 - 1.059

Silicate (umol/l): 1.936 - 5.985
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 165m.
Recorded at 165 meters.

Habitat: pelagic. Oceanic, possibly occurring in depths between 150 and 1,000 m (Ref. 6871). Feeds on planktivorous prey such as euphausid shrimps, copepods and jellyfish (Ref. 6871). May also eat small midwater fishes. Possibly less active than the basking and whale sharks (Ref. 6871). Its feeding habits and habitat suggest that it may be a rare catch in the future. Probably ovoviviparous. Males mature by 400 cm (Ref. 6871). Preyed on by the semiparasitic cookiecutter shark, @Isitius cbrasiliensis@.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found in the open ocean and believed to occur at depths of 150 to 1,000 metres (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Oceanic, possibly occurring in depths between 150 and 1,000 m (Ref. 6871). Feeds on planktivorous prey such as euphausiid shrimps, copepods and jellyfish (Ref. 6871). May also eat small midwater fishes. Possibly less active than the basking and whale sharks (Ref. 6871). Its feeding habits and habitat suggest that it may be a rare catch in the future.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

The Megamouth is a filter feeder. It uses its enormous mouth to draw in water and filter out small planktonic animals such as crustaceans and shrimp.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Exhibit ovoviparity (aplacental viviparity), with embryos feeding on other ova produced by the mother (oophagy) after the yolk sac is absorbed (Ref. 50449). Distinct pairing with embrace (Ref. 205). Size at birth
  • Castro, J.I., E. Clark, K. Yano and K. Nakaya 1997 The gross anatomy of the female reproductive tract and associated organs of the Fukouka megamouth shark (Megachasma pelagios). p. 115-119. In K. Yano, J.F. Morissey, Y. Tabumoto, and K. Nakaya. (eds.) Biology of the megamouth shark. Tokai University Press, Tokyo, Japan. 201p. (Ref. 47780)   http://www.fishbase.org/references/FBRefSummary.php?id=47780&speccode=5909 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

The megamouth reproduces sexually through internal fertilization. There are separate sexes, and the offspring are miniature versions of the adult at birth.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Megachasma pelagios

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATTTGATCTTTGGTGCATGAGCAGGAATAGTGGGAACAGCCCTAAGTCTTCTAATTCGAGCTGAATTGGGACAACCTGGGTCTCTTCTAGGAGATGATCAGATTTATAATGTCATTGTGACCGCCCACGCATTTGTAATAATTTTCTTCATGGTTATACCCGTAATAATCGGGGGGTTTGGAAACTGATTAGTACCATTAATAATTGGTGCACCAGATATGGCCTTTCCACGAATAAATAATATAAGCTTTTGATTACTCCCTCCTTCATTTCTTTTACTTTTAGCTTCAGCCGGAGTTGAAGCCGGAGCCGGTACTGGTTGAACAGTTTATCCTCCTTTAGCTGGTAATTTAGCACATGCTGGAGCATCCGTTGATTTAGCCATCTTCTCTCTTCATTTAGCAGGCATTTCATCAATTCTAGCTTCAATTAACTTTATTACAACTATTATTAACATAAAACCACCAGCCATTTCCCAATATCAAACACCATTATTTGTGTGATCAATCTTAGTAACAACTATTCTACTTCTTTTAGCACTCCCAGTACTTGCAGCCGGCATTACTATACTTCTTACTGATCGAAACCTAAACACAACATTCTTTGACCCAGCAGGAGGAGGAGACCCTATTCTTTACCAACACCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Megachasma pelagios

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2005

Assessor/s
Compagno, L.J.V.

Reviewer/s
Musick, J.A. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
This assessment is based on the information published in the 2005 shark status survey (Fowler et al. 2005).

Megamouth Shark (Megachasma pelagios) is a very large pelagic filter-feeding shark and was perhaps the most spectacular discovery of a new shark in the twentieth century (Compagno 2001). Specimens are very seldom reported, thus the shark is apparently very rare throughout its range, yet likely to be increasingly taken as bycatch in oceanic and offshore littoral fisheries. At the time of writing it was known from less than 20 specimens, though its distribution is thought to be circumtropical and wide ranging. The colouration and catch records of the megamouth shark are suggestive of epipelagic rather than deepwater habitat, as is the composition of its liver oil.

History
  • 2000
    Data Deficient
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Despite its vast size, this particular species of shark was only discovered in 1976. Less than ten have been studied or even sighted, and as a result, knowledge is limited.

IUCN Red List of Threatened Species: data deficient

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Data Deficient (DD) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This rare shark is known from less than 20 specimens since its discovery in 1976.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Taken as a rare incidental bycatch of various high-seas and coastal fisheries, including commercial littoral drift gillnets, set fish traps, and pelagic longlines and purse-seines, vulnerable to pelagic gillnets and pelagic trawls. Seldom reported. So far, specimens have been utilised by museums and oceanaria for research and display.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The lack of data concerning either the distribution or behaviour of megamouth sharks makes it particularly difficult to assess the severity and types of threats faced by this species. A number of specimens have been caught accidentally as by-catch of deepwater fishing methods and it is likely that this practice will increasingly affect population numbers (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

A greater understanding of this mysterious giant of the deep is urgently required before the necessity for any conservation measures can be properly realised or implemented.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

No negative economic effects by the megamouth shark have been reported.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Little is known about the economic importance of the megamouth shark, though sharks in general have proven to be an essential element in the aquatic ecosystem. In areas where sharks were killed because of the belief that they threatened fisheries by preying on certain fish, a significant disruption of the ecosystem (such as overpopulation of small fish and planktonic animals) occurred.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Megamouth shark

The megamouth shark (Megachasma pelagios) is an extremely rare species of deepwater shark, and the smallest of the three plankton-eating sharks besides the whale shark and basking shark. Since its discovery in 1976, only a few megamouth sharks have been seen, with 55 specimens known to have been caught or sighted as of 2012, including three recordings on film. Like the other two filter feeders, it swims with its enormous mouth wide open, filtering water for plankton and jellyfish. It is distinctive for its large head with rubbery lips. It is so unlike any other type of shark that it is classified in its own family Megachasmidae, though it has been suggested that it may belong in the family Cetorhinidae of which the basking shark is currently the sole member. Megachasma are two extinct species Megachasma comanchensis and Megachasma applegatei.

Physical characteristics[edit]

The appearance of the megamouth is distinctive, but little else is known about it. It has a brownish-black colour on top, is white underneath, and has an asymmetrical tail with a long upper lobe, similar to that of the thresher shark. The interior of its gill slits are lined with finger-like gill rakers that capture its food. A relatively poor swimmer, the megamouth has a soft, flabby body and lacks keels.

Megamouths are large sharks, able to grow to 5.5 metres (18 ft) in length. Males mature by 4 metres (13 ft) and females by 5 metres (16 ft). Weights of up to 1,215 kg (2,679 lb) have been reported. The average size of their mouth is about 1.3 meters.[citation needed]

As their name implies, megamouths have a large mouth with small teeth, and a broad, rounded snout, causing observers to occasionally mistake megamouth for a young orca. The mouth is surrounded by luminous photophores, which may act as a lure for plankton or small fish. Their mouths can reach up to 1.3 metres wide.[citation needed]

Behaviour[edit]

In 1990, a 4.9-m (16-foot) male megamouth shark was caught near the surface off Dana Point, California. This individual was eventually released with a small radio tag attached to its soft body. The tag relayed depth and time information over a two-day period. During the day, the shark swam at a depth of around 120–160 m (400–525 ft), but as the sun set, it would ascend and spend the night at depths of between 12 and 25 m (39–80 ft). Both day and night, its progress was very slow at around 1.5–2.1 km/h (1–1.3 mph). This pattern of vertical migration is seen in many marine animals as they track the movement of plankton in the water column.[1] The shark captured in March 2009 was reportedly netted at a depth of 200 m (660 ft).

Reproduction[edit]

Reproduction is ovoviviparous, meaning that the young sharks develop in eggs that remain within the mother's body until they hatch.

Discovery[edit]

The first megamouth was captured on November 15, 1976 about 25 miles off the coast from Kāneʻohe, Hawaiʻi when it became entangled in the sea anchor of United States Navy ship AFB-14. Examination of the 4.5 m (14.7 ft), 750 kg (1,650 lb) specimen by Leighton Taylor showed it to be an entirely unknown type of shark, making it one of the more sensational discoveries in 20th-century ichthyology (see also coelacanth).

Known specimens[edit]

Mouth of preserved specimen

As of 2012, only 55 megamouth specimens have been caught or sighted. They have been found in the Pacific, Atlantic and Indian oceans. Japan and Taiwan have each yielded more than 10 specimens, the most of any single area. Specimens have also been pulled from the waters near Hawaii, California, Mexico, the Philippines, Indonesia, Australia, Brazil, Senegal, South Africa, and Ecuador.

On March 30, 2009 off Burias Island in the Philippines, an 880- to 1,100-pound (400- to 500-kilogram) 4-metre (13-foot) megamouth shark died while struggling in a fisherman's net and was subsequently taken to nearby Donsol in Sorsogon province, where it was examined by scientists, before being butchered and sold.[2][3][4]

On 12 June 2011, a 3 m (10 ft) dead juvenile male was found by fishermen near the western Baja California peninsula coast, in a region called Bahía de Vizcaíno. It was picked up by the same fishing vessel that in 2006 captured another megamouth specimen in Vizcaino bay, which has led Mexican scientists to believe that the megamouth could be a seasonal visitor to the Baja Peninsula. The new specimen was taken to Ensenada, Mexico, where it was photographed and sliced in order for Scripps Institution of Oceanography and Mexican researchers to study the structure of its muscles and gills.[5]

See also[edit]

For a topical guide to this subject, see Outline of sharks.
Worldwide sightings of the megamouth shark

References[edit]

  1. ^ Piper, Ross (2007), Extraordinary Animals: An Encyclopedia of Curious and Unusual Animals, Greenwood Press.
  2. ^ Aca, E.Q. 2009. Megamouth Shark # 41: Megamouth shark in Whale Shark waters. Florida Museum of Natural History Ichthyology Department.
  3. ^ "CTV: Rare megamouth shark caught, eaten in Philippines". Ctv.ca. 2009-04-07. Retrieved 2010-06-17. 
  4. ^ "MEGAMOUTH SHARK FOUND: National Geographic". News.nationalgeographic.com. Retrieved 2010-06-17. 
  5. ^ "Elusive megamouth shark snared in Mexico". 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!