Overview

Brief Summary

Biology

Perhaps the most unique and unusual feature of seahorse biology is the fact that it is the male and not the female who becomes pregnant. When mature, males develop a pouch on the belly, known as the brood pouch. Breeding takes place in spring and summer; the female inserts her ovipositor into the male's pouch and lays her eggs. The male then fertilises them and they become embedded into the wall of the pouch. The pouch is very similar to the womb found in female mammals; a placental fluid removes waste products and supplies the eggs with oxygen and nutrients. As pregnancy progresses, this fluid gradually becomes similar to the surrounding seawater, so that when the young seahorses are 'born' the change in salinity is not too great a shock (4). After 20 to 28 days of pregnancy the male goes into labour, typically at night when there is a full moon (2) (4). After hours of thrusting, the miniature seahorses, which look exactly like the adults, are released from the pouch. (4). The offspring are fully independent after birth and must fend for themselves (4). They are pelagic in the first stage of life, or hold onto floating debris at the surface with their tail (4). Seahorses are ambush predators, and lie in wait for small crustaceans to swim by; they then suck the prey into the tube-like mouth and swallow it whole, as they do not have any teeth (5). They do not have many natural predators, as they rely on their excellent camouflage for protection, and they are unpalatable due to their bony-plated bodies (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The common seahorse is a relatively large species, which is not common as the English name suggests, but is classified as Vulnerable by the IUCN Red List of Threatened Species (2). Like all seahorses, the head is held at right angles to the body, the eyes can move independently of each other, and the tail is prehensile. Instead of having scales, as in most other fish, seahorses have a layer of skin stretched over bony plates that are visible as rings passing around the trunk (4). Swimming is powered by the rapidly oscillating dorsal fin, and they steer using the fins on either side of the body (the pectoral fins) (5). The common seahorse has a deep head and body and a thick, robust snout. Individuals are often completely black or they may be yellowish or cream with large dark spots. In common with other seahorses, this species is a master of camouflage, and may occasionally be sandy in colour in order to blend in with the background (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Inhabit seagrass and marine algae areas of estuaries and seaward reefs; also on steep mud slopes. Found in open water and attached to drifting Sargassum up to 20 km from shore. Adults in pairs (Ref. 48635). Benthic to pelagic (Ref. 58302). Feeds on zooplankton (Ref. 85309). Ovoviviparous (Ref. 205). The males carry the eggs in a brood pouch which is found under the tail (Ref. 205). Not shown to be monogamous in the laboratory (Ref. 30915). Very popular aquarium fish. Highly valued species in traditional Chinese medicine (Ref. 30915). Has been reared in captivity (Ref. 35416).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

South Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: Pakistan and India to southern Japan, Hawaii, and the Society Islands (Ref. 30915). This name is used for maybe 10 distinct species in the Indo-Pacific (Ref. 12238, 30915). International trade is monitored through a licensing system (CITES II, since 5.15.04) and a minimum size of 10 cm applies.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Hippocampus kuda occur throughout south east Asia, Australia, Japan, and some of the Pacific islands, including Hawaii (Lourie et al. 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Hippocampus kuda is strictly a marine species, widely distributed throughout the Indo-Pacific region, from the Indian Ocean to the northwestern, western central, and eastern central areas of the Pacific Ocean ("Project Seahorse", 2003; Foster et al., 2003). Approximately 23 countries have confirmed the native presence of H. kuda, ranging from Australia to China (Lourie et al., 2004). Because spotted seahorses are popular ornamental aquarium fish, their captive distribution has become global (Lally and Hough, 1999).

Biogeographic Regions: indian ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Kenya, Madagascar, Mauritius, Mozambique, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indonesia: Flores Sea, possibly Maluku.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Indonesia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indian Ocean: Maldives to western Indonesia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northwestern Pacific: Coasts of mainland China.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found throughout South East Asia, Australia, Japan and some Pacific islands (including Hawaii). There is much confusion as to the taxonomy of this seahorse, and the name Hippocampus kuda has been widely applied to all non-spiny seahorses in the region, however further research is needed to fully understand the status of this seahorse (1). Surveys on seahorse trade carried out by Project Seahorse in 2000 and 2001 have shown that the populations of this species have declined throughout the entire range, with fishers reporting massive decreases (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 17 - 18; Analspines: 0; Analsoft rays: 4
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Originally, ancient Greek poets used the Greek word Hippocampus to describe a half-horse, half-fish mythical god (hippos meaning horse and campus meaning sea monster) (Lally and Hough, 1999). This description poignantly describes their horse-like head positioned 90 degrees from its upright, armor-plated body, curved trunk, and prehensile tail ("Project Seahorse", 2003). Spotted seahorses can have an all black, grainy textured body pattern or a creamy, pale yellow body spotted with large, dark circles. These colors and patterns can be changed temporarily to match their immediate surroundings and act as a camouflage to avoid predators (Lourie et al., 1999).

Spotted seahorses are morphologically conservative and lack typical physical features of fishes such as pelvic and caudal fins, teeth, and a stomach (Lourie et al., 1999; "Project Seahorse", 2003). They also lack scales, having a layer of skin stretched over a series of bony plates instead which are visible as rings around the trunk ("Project Seahorse", 2003). These visible rings are useful in identifying various Hippocampus species.

Hippocampus fisheri can be distinguished from other seahorses by the presence of low, rounded bumps instead of the typical spines found along the body ("Project Seahorse", 2003). Spotted seahorses have a characteristically thick snout and deep head (Lourie et al., 2004). On either side of the deep head are eyes that can move independently, allowing them to maximize the search range when hunting for prey ("Project Seahorse", 2003). An adult H. kuda male can be distinguished from a female by the presence of a brooding pouch on his belly.

Seahorse lengths are measured by recording the distance from the tip of the tail to the top of the coronet, a cup-like depression found on top of the head. Adult lengths of H. kuda typically range between 7.0 and 17.0 cm (Capuli, Torres, and Froese, 2004). Adult weights, on the other hand, vary with the reproductive stages of both males and females ("Project Seahorse", 2003).

Range length: 7 to 17 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes shaped differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

30.0 cm TL (male/unsexed; (Ref. 1602))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description: (based on 80 specimens): Adult height: 7.0-17.0cm. Rings: 11+36 (34-38). Snout length: 2.3 (2.0-2.6) in head length. Dorsal fin rays: 17-18 covering 2+1 rings. Pectoral fin rays: 16 (15-18). Coronet: low-medium, rounded, overhanging at the back, often with a cup-like depression in the top; sometimes with broad flanges; not spiny. Spines: low, rounded bumps only. Other distinctive characters: deep head; deep body; thick snout. Color pattern: often totally black with a grainy texture; alternatively pale yellow or cream with fairly large, dark spots (especially females); may be sandy colored, blending in with the surroundings.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Inhabits sea grass and marine algae areas in estuaries to seaward reefs at depths to 30 m or more.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Hippocampus kuda
Catalog Number: USNM 49811
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): A. Owston
Locality: Ishigaki I., Riu Kiu, Okinawa Prefecture, Japan, Ryukyu Islands, Pacific
  • Paratype: Jordan, D. S. & Snyder, J. O. 1902. Proceedings of the United States National Museum. 24 (1241): 14.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Hippocampus kuda
Catalog Number: USNM 50626
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration; Photograph; Radiograph
Collector(s): A. Wilson
Locality: Hilo, Hawaii, Hawaii, United States, Hawaiian Islands, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; brackish; marine; depth range 0 - 68 m (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is found in shallow inshore waters up to 40–50 m deep; mangroves; seagrass beds; estuaries; and on steep mud slopes (R. Kuiter, pers. comm. in Lourieet al. 1999). It has also been recorded from open water and attached to drifting Sargassum up to 20 km away from land (Kuiter and Debelius 1994).

This species may be particularly susceptible to decline. The limited information on habitat suggests they inhabit shallow areas (Lourie et al. 1999) that are susceptible to human degradation, as well as making them susceptible to being caught as bycatch. All seahorse species have vital parental care, and many species studied to date have high site fidelity (Perante et al. 2002, Vincent et al., in review), highly structured social behaviour (Vincent and Sadler 1995), and relatively sparse distributions (Lourie et al. 1999). The importance of life history parameters in determining response to exploitation has been demonstrated for a number of species (Jennings et al. 1998).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Generally, H. kuda inhabit shallow inshore areas with an average depth of 0 to 8 m, but they have also been found at a maximum depth of 55 m (Lourie et al., 2004). They can be found in mangroves, coastal seagrass beds, estuaries, coastal bays and lagoons, harbors, sandy sediments in rocky littoral zones, and rivers with brackish waters (Lourie et al., 2004; Job et al., 2002). Spotted seahorses have also been found attached to drifting Sargasssum as far as 20 km from shore (Foster et al., 2003).

Range depth: 0 to 55 m.

Average depth: 0-8 m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: reef ; coastal

Other Habitat Features: estuarine

  • Job, S., H. Do, J. Meeuwig, H. Hall. 2002. Culturing the oceanic seahorse, Hippocampus kuda. Aquaculture, 214: 333-341.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 11 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0.915 - 183
  Temperature range (°C): 15.190 - 28.408
  Nitrate (umol/L): 0.054 - 14.438
  Salinity (PPS): 34.116 - 34.992
  Oxygen (ml/l): 3.588 - 4.725
  Phosphate (umol/l): 0.072 - 0.875
  Silicate (umol/l): 1.141 - 22.128

Graphical representation

Depth range (m): 0.915 - 183

Temperature range (°C): 15.190 - 28.408

Nitrate (umol/L): 0.054 - 14.438

Salinity (PPS): 34.116 - 34.992

Oxygen (ml/l): 3.588 - 4.725

Phosphate (umol/l): 0.072 - 0.875

Silicate (umol/l): 1.141 - 22.128
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 50m.
From 1 to 50 meters.

Habitat: demersal. Inhabits sea grass and marine algae areas of estuaries and seaward reefs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Typically inhabits shallow waters, in estuaries, reefs and on mud slopes where there is seagrass or marine algae. They have also been found in open water and attached to drifting vegetation up to 20 km off shore (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found in rocks and gravel (Ref. 52034) of the continental shelf (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Spotted seahorses are ambush predators and thrive only on live, moving food (Lally and Hough, 1999; “Project Seahorse”, 2003). They have large appetites and feed mainly on zooplankton, small crustaceans, and larval fishes. Because they are poor swimmers, H. kuda utilize their thick snouts and specialized jaws to suck in their prey (“Project Seahorse”, 2003).

Animal Foods: fish; aquatic or marine worms; aquatic crustaceans; zooplankton

Primary Diet: carnivore (Eats non-insect arthropods); planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Seahorses in general can act as food items for many larger fish, crustaceans, and water birds ("Project Seahorse", 2003). Adult seahorses themselves are voracious predators and will suck and swallow any animal that will fit in their mouths.

  • Zhang, N., B. Xu, C. Mou, W. Yang, J. Wei, L. Lu, J. Zhu, J. Du, X. Wu, L. Ye, Z. Fu, Y. Lu, J. Lin, Z. Sun, J. Su, M. Dong, A. Xu. 2003. Molecular profile of the unique species of traditional Chinese medicine, Chinese seahorse (Hippocampus kuda Bleeker). Federation of European Biochemical Socieites Letters, 550: 124-134.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Humans are the primary predators of H. kuda because of their large economic importance ("Project Seahorses", 2003). There are few natural predators of adult seahorses due to their unpalatable bony-plated bodies and their ability to avoid predation through camouflage. However, they have been found in the stomachs of loggerhead sea turtles, tunas, and dorados. Skates, rays, and crabs have also been observed to prey on seahorses.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Costia Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Monogamous pairs can often be found coiled together or within close proximity to one another (Clayton, 2003). Pairs communicate daily during male pregnancy to reinforce their relationship. (John G. Shedd Aquarium, 2004) The first few stages of the mating ritual are repeated, which include changing body color patterns, dancing, and making clicking sounds. This implies they they communicate through visual cues, sounds, and through touch. Seahorses also perceive their environment with these same senses.

Spotted seahorses are able to maximize their perception of potential prey and predators by moving their eyes independently of each other ("Project Seahorse", 2003).

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

There are 20 - 1000 larvae in incubating sacks; time of development is 20-28 days. The males carry the eggs in a brood pouch which is found under the tail (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

Eggs are fertilized by the male and become embedded in the pouch wall as they are deposited into the brooding pouch by the female through the ovipositor (“Project Seahorse”, 2003). The male may carry between 20 to 1000 eggs in its pouch (Tchi Mi, Kornienko, and Drozdov, 1996). Although fertilized eggs contain a small amount of yolk, they undergo typical teleost egg cleavage and developmental processes, which lasts for approximately 20 to 28 days. Larval development stops one week prior to the time at which they are released into the open waters.

The timing of labor in males varies depending upon species, water temperature, monsoon patterns, and lunar cycles ("Project Seahorse", 2003). However, most males go into labor at night during a full moon. Males engage in vigorous pumping and thrusting motions for several hours to release the young. Juvenile seahorses emerge from the pouch as independent, miniature adults. The average length of H. kuda at birth is 7 mm.

In general juvenile seahorses can be distinguished from their adult counterparts by differences in body proportions (Lourie et al., 2004). Young seahorses have larger heads, slimmer, spinier bodies, and higher coronets. In captivity, H. kuda have been observed to reach full maturity in 14 weeks, growing at a rate of .9 to 1.53 mm per day (Job et al.,2002).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The natural lifespan of H. kuda and its relatives are virtually unknown ("Project Seahorse", 2003). Lab and aquatic observations estimate 3 to 5 years for larger seahorse species and 1 year for smaller species.

Typical lifespan

Status: captivity:
1 to 5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Spotted seahorses maintain a faithful association with only one partner (Clayton, 2003). A new mate is sought only when a partner dies. Seahorses in general have a complex mating system, which is characterized by a unique courtship ritual (John G. Shedd Aquarium, 2004). The male begins by changing its color patterns as it dances around the female. It also produces clicking sounds with its coronet. The pair proceeds with the ritual by entwining their tails together and floating across the ocean floor. Eventually the male and female face each other belly-to-belly at which time the female places her eggs into the male’s brooding pouch with her ovipositor. This courtship ritual is modified and repeated daily even after the male has become pregnant. Each morning the pair comes together to dance, change colors, and entwine tails.

Mating System: monogamous

The age at which female and male H. kuda reach sexual maturity is unknown ("Project Seahorse", 2003). However the presence of a brooding pouch on the male - the site where the male carries the fertilized eggs- signifies male sexual maturity. Breeding occurs year round (John G. Shedd Aquarium, 2004). A female may return to lay a new batch of eggs in her partner's pouch the same day that juveniles are released. Gestation generally occurs within 20 to 28 days (Lourie et al., 2004). The maximum reported brood size is 1405, but a brooding pouch may contain anywhere from 20 to 1000 fertilized eggs. Generally only 100 to 200 juvenile seahorses are actually produced per pregnancy (Lally and Hough, 1999).

Breeding interval: Breeding may occur every 20 to 28 days.

Breeding season: Breeding occurs year round.

Range number of offspring: 1405 (high) .

Average number of offspring: 20-1000.

Range gestation period: 20 to 28 days.

Range time to independence: 20 to 28 days.

Average age at sexual or reproductive maturity (female): 14 weeks.

Average age at sexual or reproductive maturity (male): 14 weeks.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Like other seahorses, H. kuda has an unusual mode of reproduction where the female provides the eggs but the male carries and cares for the embryos in its brooding pouch ("Project Seahorse, 2003). While the male carries its brood for 20 to 28 days, the developing larvae are constantly nourshied with a placental-like fluid that is secreted within its pouch. This fluid removes waste products and supplies the fertilized eggs with oxygen and nutrients. As the pregnancy proceeds, the placental fluid gradually changes its chemical content and becomes more similar to the surrounding seawater. This fluid change minimizes the shock newborns experience when they hatch and are released into an environment with higher salt content. These newly released juveniles are fully independent and do not require any parental care once they leave the brooding pouch.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Male, Protecting: Male)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hippocampus kuda

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGATGATTTTTCTCAACTAATCACAAAGACATCGGCACCCTATACTTAGTATTTGGTGCTTGAGCCGGAATAGTCGGCACTGCACTCAGCCTTTTAATTCGAGCAGAACTAAGTCAACCAGGAGCTTTACTAGGGGAT---GACCAAATCTATAATGTTATTGTAACTGCTCATGCTTTTGTAATAATTTTCTTTATGGTTATGCCTATCATAATCGGGGGTTTTGGTAATTGACTGGTTCCCTTAATAATCGGAGCCCCTGATATAGCCTTTCCTCGAATAAATAATATGAGTTTTTGATTATTACCCCCTTCTTTTCTTCTCCTCCTTGCTTCCTCAGGAGTAGAAGCTGGAGCAGGAACAGGTTGGACTGTCTACCCTCCACTAGCAGGTAATTTAGCCCATGCTGGGGCCTCTGTAGACTTGACAATCTTTTCTCTTCATTTAGCAGGTGTTTCATCAATTCTAGGGGCTATTAACTTTATTACTACTATTATCAACATAAAACCCCCATCAATTTCACAATATCAAACACCATTGTTTGTATGAGCAGTTTTAGTAACCGCAGTTCTACTTTTACTGTCATTACCTGTGCTAGCAGCTGGGATCACTATGCTTCTTACAGACCGAAACTTAAACACAACATTCTTTGACCCTTCCGGAGGGGGAGACCCCATCCTTTATCAACACTTATTCTGATTCTTCGGACATCCTGAAGTTTATATTCTTATCCTCCCAGGTTTCGGTATAATCTCCCACATCGTAGCCTACTACTCCGGTAAAAAAGAACCTTTCGGCTACATAGGAATGGTTTGAGCAATAATAGCAATCGGGCTTTTAGGGTTCATTGTTTGGGCTCACCACATATTTACAGTAGGAATAGACGTAGACACCCGAGCATATTTCACCTCAGCAACAATAATTATCGCTATCCCCACAGGCGTAAAAGTATTTAGCTGATTAGCCACACTTCATGGGGGT---TCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hippocampus kuda

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 47
Specimens with Barcodes: 56
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A4cd

Version
3.1

Year Assessed
2003

Assessor/s
Project Seahorse

Reviewer/s
Foster, S.J., Marsden, A.D. & Vincent, A.C.J. (Syngnathid Red List Authority)

Contributor/s

Justification
H. kuda is listed as Vulnerable (VU A4cd) based on inferred declines of at least 30% caused by targeted catch, incidental capture, and habitat degradation. While there is little information on changes in numbers of the species, there is indirect evidence to suggest that declines have taken place and are continuing. This listing is consistent with the precautionary approach of the IUCN.

Hippocampus kuda is one of the most valuable species in the trades for traditional medicine, curios and aquaria (Vincent and Perry, in prep.). The demand for this species is high due to its large size, smooth texture, and pale complexion when dried (Vincent 1996), all desirable qualities for traditional medicine purposes. This species is also incidentally caught (bycatch) in other fisheries and affected by habitat degradation. Trade surveys conducted by Project Seahorse between 2000–2001 indicate that while the global trade of seahorses and other syngnathids appears to be increasing, fishers and other informants reported considerable numeric declines in seahorse catches and trade throughout the range of this species, without a commensurate decrease in effort. While the volume of this trade, and the proportion of the population that it represents, is unknown at this point, reported declines in numbers give reason for concern. We therefore suggest a precautionary listing of Vulnerable (VU A4cd).

Hippocampus kuda is also threatened by damage to its habitats. Land-based activities such as forestry often lead to increased siltation in surrounding marine waters, thereby smothering corals. Some fishing gears used by subsistence fishers on coral reefs result in substantial damage to the corals (M. Pajaro, pers. comm.). The decline in and fragmentation of the species’ habitats throughout its range raise the possibility of declines in populations in addition to those caused by fisheries.

History
  • 1996
    Vulnerable
    (Baillie and Groombridge 1996)
  • 1996
    Vulnerable
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Spotted seahorses are listed as vulnerable under the World Conservation Union’s IUCN Red List and are on the CITES Appendix II (Lally and Hough, 1999). Population numbers of H. kuda in the wild are unknown but scientists, conservationists, and traders agree that populations have declined by at least 30% due to habitat destruction, pollution, bycatch, trades in traditional Chinese medicine, curios, and aquaria (Lally and Hough, 1999; Project Seahorse et al, 2003). There is little legal oversight or regulation on trading, and few countries require permits (Lally and Hough, 1999).

Scientists predict further declines in H. kuda population without immediate intervention (Lally and Hough, 1999). Implementing effective conservation methods has been hampered by confusion over H. kuda taxonomy, which has been driven by the difficulty in morphologically distinguishing them from their relatives, their ability to camouflage, current lack of descriptions, and unestablished, independent naming designations (Lourie et al., 1999). Taxonomic definitions must be established first before researchers can confidently understand the biology, ecology, and relative abundance of spotted seahorses.

Seahorse farming is currently being developed as an alternative strategy to conserve native seahorse populations while helping fishers to continue earning a sustainable income (Job et al., 2002). Initial research of H. kuda’s ability to grow and survive appears very promising, but further research is needed to determine whether aquaculturing of the spotted seahorse on a more larger scale effectively meets the high market demand while preventing further depletion of native populations.

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU A4cd) by the IUCN Red List 2003 (1). All seahorses are listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
While exact population numbers for H. kuda remain unknown, Project Seahorse trade surveys conducted between 2000–2001 have inferred that seahorse numbers in the wild appear to have declined throughout its range. For example, in Hong Kong traders reported that local seahorses, while common 30 years ago, were rarely found in 2000, with the decrease in availability attributed to habitat destruction and pollution (B. Kwan, unpublished data). In India half of the surveyed fishers (n=80/160) reported decreases in catch of seahorses (A. Perry, unpublished data), while in the Philippines fishers targeting seahorses specifically (n=7) reported declines of between 50% and 95% from as early as 1980 and as recently as 1997 (M. Pajaro, unpublished data). The fishers in the Philippines cited overfishing, the increasing population of fishers and indiscriminate catch of seahorses, including pregnant and immature seahorses, as causes of the decline in catch (M. Pajaro, unpublished data).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Vulnerable (VU) (A4cd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Hippocampus kuda is caught and traded for traditional medicines, aquaria and curios throughout its range (Vincent and Perry, in prep.). It is one of the most valuable seahorses in traditional Chinese medicine (Vincent and Perry, in prep.), is a popular aquarium fish (Lourie et al. 1999) and is caught in India for the traditional medicine trade (Marichamy et al. 1993). In general, indiscriminate catch, habitat degradation and exploitation are potential threats to this species.

For example, in Hong Kong seahorses are threatened by habitat degradation and pollution, and may be susceptible to incidental catch in the shrimp trawl fishery (B. Kwan, unpublished data). In China seahorses are caught as bycatch although no information exists on volumes. In the Philippines declines in seahorse availability are attributed to overfishing, an increasing number of fishers, and non-selective catch of seahorses (e.g., taking pregnant or immature seahorses) and habitat destruction (M. Pajaro, unpublished data).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species is sold locally and internationally for use in traditional medicines, in the aquarium trade and as curios (1). It is one of the most valuable seahorses in traditional Chinese medicine and is very popular as an aquarium species. In 2001, the global consumption of seahorses was estimated at 25 million seahorses (over 70 metric tonnes) (3). Furthermore, habitat degradation and pollution in some areas reduces the available habitat for the species, and it is also often accidentally caught as by-catch in the shrimp-trawling industry (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The entire genus Hippocampus was listed in Appendix II of CITES in November 2002. Implementation of this listing will begin May 2004. The Australian populations of this species were moved under the Australian Wildlife Protection Act in 1998, so export permits are now required. The permits are only granted for approved management plans or captive bred animals. Such management was transferred under the new Environment Protection and Biodiversity Conservation Act in 2001. Many states also place their own controls on the capture and/or trade of syngnathid fishes. All seahorses are listed on Schedule I of India’s Wildlife (Protection) Act, 1972, banning their capture and trade. In Singapore, H. kuda is recognized as being threatened by habitat destruction and harvesting for medicinal use and the aquarium trade and harvest is not allowed except by permit. They are listed as vulnerable in the National Red Data Books in Singapore and Viet Nam. In France it is illegal to import seahorses under the name H. kuda.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The most pressing requirement to assist in the conservation of this species is the need for further research. In order to effectively conserve a species, its biology, ecology, range and abundance must be fully understood and the threats facing it must be known (6). In November 2002 all seahorses were listed on Appendix II of the Convention on International Trade in Endangered Species (CITES); this means that the massive trade in seahorses must be regulated to ensure that the survival of wild populations is not threatened. However, Indonesia, Japan, Norway and South Korea have opted out of the listing for seahorses (3). The conservation organisation Project Seahorse was set up in 1994 to in response to the massive pressures facing all seahorses around the world (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; aquaculture: commercial; aquarium: commercial; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Spotted seahorses have no negative effects on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Spotted seahorses are the most valuable species in the traditional Chinese medicine trade (TCM) due to their large size, smooth texture, and pale complexion when dried (Project Seahorse et al, 2003). According to traders, TCM books, and recent pharmacological studies, seahorses can regulate urinogenital, reproductive, nervous, endocrine, and immune systems as well as mimic certain hormones related to aging, tumor development, and fatigue (Zhang et al., 2003). None of these uses, however, have been tested. The global consumption of seahorses for medicinal purposes during the year 2001 alone has been estimated at 25 million seahorses or 70 metric tones (“Project Seahorse”, 2003).

Spotted seahorses are very popular among aquatic collectors as a favorite aquarium fish (Lally and Hough, 1999). Over 51 nations and territories are involved in buying and selling H. kuda and its relatives (Job et al., 2002). The largest known exporters of seahorses are Thailand, Vietnam, India, and the Philippines, and the bulk of seahorses are fished from the Indo-Pacific region (Xu et al., 2003).

Seahorses are fascinating to many people and diving trips to see seahorses, as well as other fish, are important in marine ecotourism.

Positive Impacts: pet trade ; body parts are source of valuable material; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Hippocampus kuda

Hippocampus kuda, also known as the common seahorse, estuary seahorse, or yellow seahorse is a member of the family Syngnathidae (seahorses and pipefishes] of the order Syngnathiformes.[2] The common sea horse is a small, equine-like fish, with extraordinary breeding methods.[3] Greeks and Romans believed the seahorse was an attribute of the sea god Poseidon/Neptune, and the seahorse was considered a symbol of strength and power. Europeans believed that the seahorse carried the souls of deceased sailors to the underworld - giving them safe passage and protection until they met their soul's destination.[4] The common seahorse is considered a vulnerable species.[1]

Contents

Reproduction

The male carries the eggs in a brood pouch on his lower abdomen. After courtship the pair come close together so that the female's oviduct is close to, if not resting on, the brood pouch of the male, and the female expels some eggs into the pouch. This happens several times until spawning is complete. The male then wiggles about, as if to rearrange the eggs within his pouch. The exact point at which fertilization takes place is not known, though many assume that it occurs while the eggs are in the pouch. The incubation period is generally four to five weeks. To "give birth" the male bends forwards and then backwards, thrusting his pouch forward expelling one or two youngsters with explosive force. Raising the fry in an aquarium is difficult, as they require a large amount of minuscule live food.[5]

Range and habitat

The common seahorse can be found in a variety of habitats in the shallow coastal waters of the Indo-Pacific, including coral reefs, muddy slopes, and shallow estuaries. [3][2] The common seahorse has been observed to use its prehensile tail to anchor itself to coral branches or floating sargassum in the wild.[2][5]

Physical description

The sea horse's swimming position is vertical, with slight forward or backward inclinations, in the direction of travel. The body is covered with armored plates. An equine-like head set at right angles to the body ends in a long tubular snout. A bony "coronet" may develop on the head.[3] The male seahorse broods fertilized eggs in a small pouch in its lower abdomen. Females are slightly smaller.[3]

In aquaria

A common seahorse anchored to coral

Common seahorses have very small mouths, eating only small animals like brine shrimp and even newborn guppies. Seahorses need to eat frequently—4-5 times a day. Many aquarists who have kept this species cultivate their own brine shrimp, and rotifers. Daphnia is eaten when other foods are unavailable.[5]

Seahorses spend most of their time anchoring to coral reefs and branches with their tails, made necessary because they are poor swimmers. The need similar anchor points In aquaria. Seahorses like a quiet tank, without large, belligerent fish, and a slow-moving current. Aquarists have found them to be generally accepting of tankmates like "Synchiropus splendidus" '(Mandarinfish) and other bottom dwelling fishes.[5]

Temperature, pH, and salinity

Common seahorse generally do best at a temperature of 72–77 °F (22–25 °C), optimally 73–75 °F (23–24 °C). They do not tolerate even spikes above 80 °F (27 °C) well.[6] Their optimal pH range is around 8.1-8.4.[7] The common seahorse can tolerate a range of salinity from 18 parts per thousand (ppt) to 36 ppt but salinity below about 25ppt should be promptly corrected. About 32 ppt is ideal.[8]

Conservation

The common seahorse (H. kuda) is considered a vulnerable species by the IUCN[1] and therefore international trade of this common aquarium species has been monitored by CITES since 2004. The common seahorse is now commercially cultured to help cope with the demand for seahorses for traditional Chinese medicines, souvenirs, and the aquarium industry.[2]

References

  1. ^ a b c "Hippocampus kuda". IUCN red list of threatened species. International Union for Conservation of Nature. 2008. http://www.iucnredlist.org/apps/redlist/details/full/10075/0.
  2. ^ a b c d "Hippocampus kuda". Fishbase. http://www.fishbase.org/summary/speciessummary.php?id=5955. Retrieved 5 Sept 2012.
  3. ^ a b c d Mills, Dick. Aquarium Fish: The visual guide to more than 500 marine and freshwater fish varieties. Eyewitness Handbooks. p. 281.
  4. ^ Venefica, A.. "Symbolic Meaning of the Seahorse". Whats-Your-Sign.com. http://www.whats-your-sign.com/symbolic-meaning-of-the-seahorse.html.
  5. ^ a b c d Bailey, Mary; Gina Sandford. The Ultimate Encyclopedia of Aquarium Fish & Fish Care. p. 239.
  6. ^ Giwojna, Pete (16 January 2006). "Re:KH is killing me!". Seahorse Forums. Ocean Rider Club. http://www.seahorse.com/index.php?option=com_joomlaboard&Itemid=218&func=view&id=624&view=flat&catid=2.
  7. ^ Giwojna, Pete (6 January 2006). "Re:Maybe Seahorses?". Seahorse Forums. Ocean Rider Club. http://www.seahorse.com/index.php?option=com_joomlaboard&Itemid=218&func=view&view=threaded&id=614&catid=2.
  8. ^ "Setting up your seahorse aquarium". Seahorse Australia. http://www.seahorse-australia.com.au/pages/aquar_setup.html.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!