Overview

Comprehensive Description

Biology

Mainly inhabits coral reefs. Sometimes forming large aggregations around rocky outcrops during daylight hours. Disperses to feed at night (Ref. 9710). Usually marketed fresh.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Pacific: restricted to the east coast of Australia and New Caledonia. The main Australian distribution is off southern Queensland between Cape Moreton (about 27°S) and the Capricorn Group(23°S). This species has been usually referred to as Lutjanus amabilis by previous authors.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10; Dorsal soft rays (total): 14; Analspines: 3; Analsoft rays: 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

50.0 cm TL (male/unsexed; (Ref. 55)); max. reported age: 40 years (Ref. 2290)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Snout somewhat pointed. Preopercular notch and knob moderately well developed. Scale rows on back rising obliquely above lateral line. Generally pale blue-gray to whitish with suffusion of yellow on upper back. A prominent golden brown stripe, slightly narrower than the eye, runs laterally from the rear edge of the of the opercle to the caudal peduncle.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range ? - 20 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 63 specimens in 1 taxon.
Water temperature and chemistry ranges based on 36 samples.

Environmental ranges
  Depth range (m): 20 - 82.5
  Temperature range (°C): 23.278 - 25.577
  Nitrate (umol/L): 0.782 - 2.380
  Salinity (PPS): 35.248 - 35.493
  Oxygen (ml/l): 4.190 - 4.703
  Phosphate (umol/l): 0.083 - 0.308
  Silicate (umol/l): 0.736 - 1.453

Graphical representation

Depth range (m): 20 - 82.5

Temperature range (°C): 23.278 - 25.577

Nitrate (umol/L): 0.782 - 2.380

Salinity (PPS): 35.248 - 35.493

Oxygen (ml/l): 4.190 - 4.703

Phosphate (umol/l): 0.083 - 0.308

Silicate (umol/l): 0.736 - 1.453
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 20m.
Recorded at 20 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Mainly inhabits coral reefs. Sometimes forming large aggregations around rocky outcrops during daylight hours. Disperses to feed at night (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lutjanus adetii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGCACCGCCCTAAGCTTGCTCATTCGAGCAGAACTTAGCCAACCAGGAGCTCTTCTTGGAGACGACCAGATTTACAATGTAATCGTTACAGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCAATCATGATCGGAGGATTCGGAAACTGACTAATTCCACTTATGATCGGAGCCCCCGACATGGCGTTCCCCCGAATAAATAACATGAGCTTTTGACTCCTCCCTCCCTCTTTCCTTCTTCTGCTCGCATCCTCTGGAGTCGAAGCCGGGGCCGGGACTGGATGAACAGTTTATCCCCCACTAGCAGGAAACCTCGCACACGCAGGTGCATCCGTTGATCTAACCATCTTCTCTCTTCATCTAGCCGGTGTTTCTTCGATCTTAGGCGCTATCAATTTTATTACTACGATTATTAACATGAAACCACCAGCCATTTCCCAGTACCAAACACCCCTATTCGTCTGAGCTGTCCTAATTACAGCAGTCCTTCTCCTTCTTTCCCTTCCGGTCCTAGCTGCTGGAATTACAATGCTTCTTACAGACCGAAATTTAAACACCACCTTCTTTGACCCCGCAGGCGGAGGAGATCCCATCCTTTACCAGCACCTCTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lutjanus adetii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 5 specimens with morphological vouchers housed at Museum of Tropical Queensland
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; price category: high; price reliability: questionable: based on ex-vessel price for species in this genus
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Yellow-banded snapper

The yellow-banded snapper, Lutjanus adetii, is a species of snapper native to the eastern coast of Australia and New Caledonia. It is an inhabitant of coral reefs, congregating around rocky outcrops during the day and feeding at night. It can be found at depths to 20 m (66 ft). It can reach a length of 50 cm (20 in), though most do not exceed 30 cm (12 in).[1] It is pink or grayish-blue with bright yellow markings around its eyes and a yellow stripe along its neck to tail on each side. This species is of minor importance to local commercial fisheries and is sought after as a game fish.[1]

References[edit]

  1. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2013). "Lutjanus adetii" in FishBase. December 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!