Overview

Comprehensive Description

Biology

Adults occur usually in slow-moving rivers, estuaries and the upper reaches of backwaters. Prefers shady, marginal areas. Feed on mollusks, crustaceans and other invertebrates as well as vascular plants and detritus. Occasionally feed on fish scales and fins (Ref. 12693). The muscular tissue and viscera are extremely toxic. Common in the aquarium trade, but adults are known to be pugnacious and aggressive with its tankmates (Ref. 12693).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Asia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Asia: India, Sri Lanka, Bangladesh, Myanmar and Borneo (Ref. 4833). Recorded from the Mekong delta (Ref. 12693).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 143 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

17.0 cm TL (male/unsexed; (Ref. 4833))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; potamodromous (Ref. 51243); freshwater; brackish
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 17 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0.5 - 428
  Temperature range (°C): 28.885 - 28.885
  Nitrate (umol/L): 0.075 - 0.075
  Salinity (PPS): 32.200 - 32.200
  Oxygen (ml/l): 4.427 - 4.427
  Phosphate (umol/l): 0.339 - 0.339
  Silicate (umol/l): 4.465 - 4.465

Graphical representation

Depth range (m): 0.5 - 428
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Lays 200 eggs which are attached to a hard, flat submerged surface in shallow water. A parent guards the eggs until hatching. Adults have been observed tending schools of fry (Ref. 6028).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Tetraodon fluviatilis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Tetraodon nigroviridis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGCTGATTTTTCTCAACCAACCATAAAGACATCGGCACCCTCTACCTAGTATTTGGTGCCTGAGCCGGAATAGTAGGGACGGCCCTTAGCCTCCTCATCCGAGCTGAACTTAGCCAACCAGGCGCACTCTTGGGTGAT---GACCAGATTTATAATGTAATCGTTACAGCCCATGCATTTGTAATAATTTTCTTTATAGTAATGCCAATCATGATTGGCGGCTTTGGAAACTGACTAGTGCCCCTCATGATTGGAGCACCTGACATGGCATTCCCCCGAATAAATAACATAAGCTTTTGGCTACTACCTCCTTCCTTCCTACTCCTCCTAGCATCCTCCGGCGTAGAAGCTGGGGCTGGTACAGGCTGAACCGTCTACCCCCCACTAGCAGGCAACCTGGCCCACGCCGGAGCTTCCGTTGACCTAACCATCTTCTCCCTCCACCTGGCCGGTGTCTCATCGATTTTAGGGGCCATTAACTTTATCACCACCATCATTAACATAAAACCCCCAGCCATCTCCCAATATCAGACCCCTCTCTTCGTATGAGCCGTCCTAATTACTGCCGTCCTTCTCCTACTGTCCTTGCCAGTCCTCGCAGCCGGGATCACAATGCTTCTAACAGACCGAAACCTAAACACCACTTTCTTCGACCCTGCAGGCGGAGGAGACCCAATTCTTTACCAACACTTATTCTGATTCTTTGGCCACCCAGAAGTGTACATTCTCATCTTACCAGGCTTTGGAATAATCTCCCATATTGTTGCCTACTATGCCGGCAAAAAAGAACCATTCGGCTACATGGGCATGGTTTGAGCCATGATGGCTATTGGCCTTCTAGGCTTCATCGTCTGAGCCCACCATATGTTTACGGTAGGAATGGACGTTGACACCCGCG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetraodon nigroviridis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Tetraodon nigroviridis

Tetraodon nigroviridis is one of the pufferfish known as the green spotted puffer. It is found across South and Southeast Asia in coastal freshwater and brackish water habitats.[1] T. nigroviridis reaches a typical maximum length of about 15 cm (5.9 in), with reports of up to 17 cm.[2] In February 2009, it was successfully bred in captivity at University of Florida using a new variation of the ovarian lavage technique.[3][4]

In the aquarium[edit]

This pufferfish, known as Midori fugu in Japanese, is a popular aquarium pet. Typically younger fish are sold with a length of 2–3 cm. These fish can be kept with others of the same type, or other fish, but they are a rather aggressive species, so they will often nip the fins or scales of other slow-moving fish. Although they may reach 15 cm in nature, they rarely exceed 10 cm in captivity. These fish are omnivores, and tend to feed mainly on small invertebrates and plant matter (such as seaweed) in nature. In captivity, they can be fed live bait or frozen bloodworms, but they can eat manufactured fish food if they are raised on it from a young age. One issue in feeding them manufactured food is that their teeth continuously grow, and in nature eating hard invertebrates helps grind their teeth down. Without hard food, their teeth continue to grow until it causes health problems. These problems can be solved by using fine coral sand in the tank, which the fish chew. Also, occasional feeding of snails or ghost shrimp can wear down their teeth naturally.

In nature, this species often travels to the limits of where salt water becomes fresh water, so they can be kept in fresh water for brief times. For long-term care, however, they should be kept in salt water. A salt concentration equal to 1/4th of ocean levels is suitable for younger fish, but adult fish spend most of their time in the ocean, so it is recommended to raise the salt level to 1/2 of ocean levels. Some also recommend using normal ocean water levels for adult fish. Suitable temperatures are 24-28°C. A pH level of 8 is recommended.

Ecology[edit]

Adults of T. nigroviridis are found in freshwater streams, rivers, and flood plains; young are found in brackish water.[5] They are also found in mangrove forests.[1] Their diet consists primarily of snails, but includes mollusks, crustaceans, and some plant material.[5] This species may also be lepidophagous.[5]

Genetics[edit]

T. nigroviridis has the smallest known vertebrate genome, roughly 340 million base pairs,[6] and has thus been selected as a model organism for genetics. In 2004, a draft of its genome sequence was published.[6]

Color[edit]

T. nigroviridis' is green on the body with black spots. Its belly is white and its fins and tail are light green.[citation needed]

Commercial importance[edit]

T. nigroviridis is by no means a food fish, but has some value as bait and is very widely traded as an aquarium fish,[5] and is sometimes mistaken as the Ceylon puffer, Tetraodon fluviatilis. T. nigroviridis also has some value as a lab animal, in particular in genetics, because it has the same number of genes as human beings, but in a genome about one-tenth the size.[7]

References[edit]

  1. ^ a b Ebert, Klaus (2001-05-31). Aqualog: The Puffers of Fresh and Brackish Waters. Hollywood Import & Export, Inc. ISBN 3-931702-60-X. 
  2. ^ Schäfer F: Brackish Water Fishes, Aqualog 2005, ISBN 3-936027-82-X
  3. ^ "University of Florida breeds spotted green puffer fish". AquaDaily. 2009-02-20. Retrieved 2009-02-20. 
  4. ^ http://news.ufl.edu/2009/02/17/puffer-fish/
  5. ^ a b c d Froese, Rainer and Pauly, Daniel, eds. (2007). "Tetraodon nigroviridis" in FishBase. August 2007 version.
  6. ^ a b Jaillon O, Aury J, Brunet F, Petit J, Stange-Thomann N, Mauceli E, Bouneau L, Fischer C, Ozouf-Costaz C, Bernot A, Nicaud S, Jaffe D, Fisher S, Lutfalla G, Dossat C, Segurens B, Dasilva C, Salanoubat M, Levy M, Boudet N, Castellano S, Anthouard V, Jubin C, Castelli V, Katinka M, Vacherie B, Biémont C, Skalli Z, Cattolico L, Poulain J, De Berardinis V, Cruaud C, Duprat S, Brottier P, Coutanceau J, Gouzy J, Parra G, Lardier G, Chapple C, McKernan K, McEwan P, Bosak S, Kellis M, Volff J, Guigó R, Zody M, Mesirov J, Lindblad-Toh K, Birren B, Nusbaum C, Kahn D, Robinson-Rechavi M, Laudet V, Schachter V, Quétier F, Saurin W, Scarpelli C, Wincker P, Lander E, Weissenbach J, Roest Crollius H (2004). "Genome duplication in the teleost fish Tetraodon nigroviridis reveals the early vertebrate proto-karyotype". Nature 431 (7011): 946–57. doi:10.1038/nature03025. PMID 15496914. 
  7. ^ "Pufferfish and ancestral genomes". Retrieved 2013-01-18. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!