Overview

Comprehensive Description

Biology

Adults usually occur over mud in swamps, vegetated sloughs, ponds, lakes, backwaters, and quiet pools of creeks and small to large rivers (Ref 5723, 10294). Nocturnal feeders. Feed on aquatic insects, small crustaceans, and occasional small fish including their own young (Ref. 10294). Eggs in nests are guarded by both parents (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) This fish is widespread throughout the lowlands of the Atlantic and Gulf slopes of North America (north to Long Island, New York; west to eastern Texas); it also occurs in the Great Lakes and Mississippi river basins from Michigan, Wisconsin, and Minnesota to the Gulf of Mexico (Page and Burr 2011) A disjunct population occurs in the Niagara River-Lake Ontario drainage, New York (Page and Burr 2011).

Subspecies sayanus: Atlantic Slope south to the northern Florida.

Subspecies gibbosus: Gulf Slope west of the Mississippi River, Mississippi Valley, and Great Lakes. Intergrades occur from the Saint Marys River of the Atlantic Slope west to the Pearl River of the Gulf Slope (Boltz and Stauffer 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This fish is widespread throughout the lowlands of the Atlantic and Gulf slopes of North America (north to Long Island, New York; west to eastern Texas); it also occurs in the Great Lakes and Mississippi river basins from Michigan, Wisconsin, and Minnesota to the Gulf of Mexico (Page and Burr 2011) A disjunct population occurs in the Niagara River-Lake Ontario drainage, New York (Page and Burr 2011).

Subspecies sayanus: Atlantic Slope south to the northern Florida.

Subspecies gibbosus: Gulf Slope west of the Mississippi River, Mississippi Valley, and Great Lakes. Intergrades occur from the Saint Marys River of the Atlantic Slope west to the Pearl River of the Gulf Slope (Boltz and Stauffer 1993).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Pirate perch are found only in North America. They are believed to have occupied the Mississippi Valley before the ancestors of most modern-day fishes had migrated into the region. Today pirate perch are found throughout the lowlands and surrounding areas of the southeastern Ozarks, in lakes and pools east of the Mississippi River and as far south as eastern Texas.

Biogeographic Regions: nearctic (Native )

  • Pflieger, W. 1975. The Fishes of Missouri.. Missouri: Missouri Department of Conservation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern and central United States. Two subspecies sometimes recognized as by Boltz and Stauffer 1993 [ref. 20308] -- *sayanus* in Atlantic coast drainages, with intergrades in drainages between Mississippi and Georgia; and *gibbosus* in the Mississippi R
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America: Eastern and central United States. Two subspecies were recognized by Boltz & Stauffer 1993 (Ref. 34807): Aphredoderus sayanus sayanus in Atlantic Coast drainages from New York to Georgia; and A. sayanus gibbosus in the Mississippi River, Great Lakes, and western Gulf Coast drainages, with intergrades in Gulf Coast and Atlantic Coast drainages between Mississippi and Georgia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Aphredoderus sayanus is found only in North America and is believed to have occupied the Mississippi Valley before the ancestors of most modern-day fishes had migrated into the region (Pflieger, 1975). Today pirate perch are found throughout the lowlands and surrounding areas of the southeastern Ozarks, in lakes and pools east of the Mississippi River and as far south as eastern Texas.

Biogeographic Regions: nearctic (Native )

  • Pflieger, W. 1975. The Fishes of Missouri.. Missouri: Missouri Department of Conservation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern and central United States. Two subspecies sometimes recognized as by Boltz and Stauffer 1993 [ref. 20308] -- *sayanus* in Atlantic coast drainages, with intergrades in drainages between Mississippi and Georgia; and *gibbosus* in the Mississippi R
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Pirate perch are grayish with black speckles and have a narrow, vertical, dark bar at the base of the tail fin and under the eye. Pirate perch have a single dorsal fin and ctenoid scales (scales with ridged edges) on the head and body. The tail fin is slightly notched, not deeply forked. The gill cover has a sharp spine. Dorsal and anal fins each have 2 or 3 weak spines at front. The mouth is moderately large with a slightly projecting lower jaw. The lateral line (an additional sensory organ used to feel small vibrations) is underdeveloped in pirate perch from the Midwest, but specimens closer to the Atlantic coast show a much better developed lateral line. Also pirate perch are sexually dimorphic with females being larger and more full-bodied than males. Pirate perch are unusual in that their urogenital opening (opening for excretion and reproduction) is positioned far forward on their body and is actually located under the throat. This feature is not present in juveniles because the anus shifts forward with maturity.

Range length: 6.35 to 12.7 mm.

Average length: 6.1 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger; sexes shaped differently

  • Eddy, S. 1969. How to know the Freshwater Fishes: Second Edition. Dubuque, IA: Wm. C. Brown Company Publishers.
  • Clay, W. 1962. A Field Manual of Kentucky Fishes. Frankfort, KY: Kentucky Department of Fish and Wildlife Resources.
  • Tiemann, J. 2004. Observations of the pirate perch, Aphredoderus sayanus (Gilliams), with comments on sexual dimorphism, reproduction, and unique defecation behavior.. Journal of Freshwater Ecology, 19(1): 115-121.
  • 2006. "Merriam Webster Online" (On-line). Accessed September 12, 2006 at http://m-w.com/dictionary/urogenital.
  • Fletcher, D., E. Dakin, B. Porter, J. Avise. 2004. Spawning Behavior and Genetic Parentage in the Pirate Perch (Aphredoderus sayanus), a Fish with an Enigmatic Reproductive Morphology.. Copeia, 1: 1-10.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Pirate perch are unusual in that their urogenital opening is positioned far anteriorally under the throat (Fletcher, et. Al. 2004). This feature is not present in juveniles, as the anus migrates with maturity. Pirate perch are grayish with black speckles and have a narrow, vertical, dark bar at the base of the tail fin and under the eye (Pflieger, 1975). Pirate perch have a single dorsal fin and ctenoid scales on the head and body. The tail fin is slightly notched, not deeply forked. The gill cover has a sharp spine. Dorsal and anal fins each have 2 or 3 weak spines at front (Pflieger, 1975). The mouth is moderately large with a slightly projecting lower jaw (Clay, 1962). The lateral line is incomplete or underdeveloped in pirate perch from the Midwest, but specimens closer to the Atlantic coast show a much better developed lateral line (Eddy, 1969). Pirate perch are sexually dimorphic with females being larger and more full-bodied than males (Tiemann, 2004).

Range length: 6.35 to 12.7 mm.

Average length: 6.1 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger; sexes shaped differently

  • Eddy, S. 1969. How to know the Freshwater Fishes: Second Edition. Dubuque, IA: Wm. C. Brown Company Publishers.
  • Clay, W. 1962. A Field Manual of Kentucky Fishes. Frankfort, KY: Kentucky Department of Fish and Wildlife Resources.
  • Tiemann, J. 2004. Observations of the pirate perch, Aphredoderus sayanus (Gilliams), with comments on sexual dimorphism, reproduction, and unique defecation behavior.. Journal of Freshwater Ecology, 19(1): 115-121.
  • 2006. "Merriam Webster Online" (On-line). Accessed September 12, 2006 at http://m-w.com/dictionary/urogenital.
  • Fletcher, D., E. Dakin, B. Porter, J. Avise. 2004. Spawning Behavior and Genetic Parentage in the Pirate Perch (Aphredoderus sayanus), a Fish with an Enigmatic Reproductive Morphology.. Copeia, 1: 1-10.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 14 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 140 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 140 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

14.0 cm TL (male/unsexed; (Ref. 5723)); max. reported age: 4 years (Ref. 12193)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Syntype for Aphredoderus sayanus
Catalog Number: USNM 17853
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1876
Locality: Calumet River Ills., Illinois, United States, North America
  • Syntype: Nelson, E. W. 1876. Bulletin of the Illinois Museum of Natural History. 1 (1): 39.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Habitat includes clear to turbid lakes, ponds, marshes, quiet pools, and backwaters of low gradient streams (creeks to large rivers) with soft bottoms and abundant aquatic plants, organic debris, and other cover (Lee et al. 1980, Page and Burr 2011). Eggs apparently are brooded in the buccal cavity (Becker 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Habitat includes clear to turbid lakes, ponds, marshes, quiet pools, and backwaters of low gradient streams (creeks to large rivers) with soft bottoms and abundant aquatic plants, organic debris, and other cover (Lee et al. 1980, Page and Burr 2011). Eggs apparently are brooded in the buccal cavity (Becker 1983).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pirate perch are found in clear warm water with low currents, for example bottomland lakes, overflow ponds and the quiet pools and backwaters of low-gradient streams. Within these areas pirate perch tend to congregate where there is dense vegetation, woody debris, root masses and undercut banks.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

  • Monzyk, F., W. Kelso, D. Rutherford. 1997. Characteristics of Woody Cover Used by Brown Madtoms and Pirate Perch in Coastal Plain Streams. Transactions of the American Fisheries Society, 126: 665-675.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pirate perch are found in clear warm water with low currents; these include bottomland lakes, overflow ponds and the quiet pools and backwaters of low-gradient streams (Pflieger, 1975). Within these areas pirate perch tend to congregate where there is dense vegetation, woody debris, root masses and undercut banks (Monzyk et al., 1997).

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

  • Monzyk, F., W. Kelso, D. Rutherford. 1997. Characteristics of Woody Cover Used by Brown Madtoms and Pirate Perch in Coastal Plain Streams. Transactions of the American Fisheries Society, 126: 665-675.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0.08 - 0.75

Graphical representation

Depth range (m): 0.08 - 0.75
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Eats mainly various invertebrates, especially insects (Becker 1983, Smith 1979).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

This carnivorous fish eats primarily immature aquatic insects, small crustaceans and sometimes small fish.

Animal Foods: fish; insects; aquatic crustaceans

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Usually occurs over mud in swamps, vegetated sloughs, ponds, lakes, backwaters, and quiet pools of creeks and small to large rivers. Also Ref. 50639.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

This carnivorous fish eats primarily immature aquatic insects, small crustaceans and sometimes small fish (Pflieger, 1975).

Animal Foods: fish; insects; aquatic crustaceans

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Pirate perch are solitary and secretive, hiding during the daylight hours in thick growths of aquatic plants or accumulations of organic debris. They are mainly active at night. Pirate perch impact the populations of their small, invertebrate prey.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

In the root masses that the pirate perch use for spawning adult and juvenile salamanders, as well as eastern dobsonfly larvae (Corydalus_cornutus), have been found. It is unclear whether these animals are predators of the eggs or not. Adult pirate perch may be eaten by larger fish, piscivorous birds, otters or mink.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Pirate perch are solitary and secretive, hiding during the daylight hours in thick growths of aquatic plants or accumulations of organic debris. They are mainly active at night (Pflieger, 1975). Pirate perch impact the populations of their small, invertebrate prey.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

In the root masses that the pirate perch use for spawning, adult and juvenile salamanders, as well as eastern dobsonfly larvae (Corydalus cornutus), have been found. It is unclear whether these animals are predators of the eggs or not (Fletcher, et al 2004). Adult pirate perch may be eaten by larger fish, piscivorous birds, otters or mink.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 - 300

Comments: This species is represented by a large number of occurrences (subpopulations) (e.g., see map in Lee et al. 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Comments: Total adult population size is unknown but presumably exceeds 100,000. This fish is very common in suitable habitat in much of its range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Four age classes found in Oklahoma population.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

In addition to the lateral line sensory system present in most fishes an extensive array of sensory pores on the head of pirate perches may enable these nocturnal fishes to navigate in the dark. There is little known about communication in this species.

Perception Channels: vibrations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

In addition to the lateral line sensory system present in most fishes, an extensive array of sensory pores on the head of A. sayanus may enable these nocturnal fishes to navigate in the dark (Fletcher et al., 2004). There is little known about communication in this species.

Perception Channels: vibrations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Becomes active just after dark and activity peaks at dawn (Becker 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Larval pirate perch look very similar to adults except in the placement of the anus. As stated above the anus shifts forward as pirate perch mature.

  • Hogue, J. 1976. Preliminary Guide to the Identification of Larval Fishes in the Tennessee River. Tennessee: Tennessee Valley Authority Division of Forestry, Fisheries, and Wildlife Development.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eggs in nests are guarded by both parents (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

Larval pirate perch look very similar to adults, except in the placement of the anus. Prolarvae and early postlarvae have 12-15 preanal and 13-196 postanal myomeres (Hogue, 1976). Once these fish reach 13 mm, the number of preanal myomeres will decrese as the anus begins migration toward the gular region (Hogue, 1976).

  • Hogue, J. 1976. Preliminary Guide to the Identification of Larval Fishes in the Tennessee River. Tennessee: Tennessee Valley Authority Division of Forestry, Fisheries, and Wildlife Development.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Maximum longevity in the wild is 4 years.

Range lifespan

Status: wild:
unknown to unknown years.

Average lifespan

Status: wild:
4 years.

Range lifespan

Status: captivity:
unknown (low) hours.

Average lifespan

Status: captivity:
4 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Maximum longevity in the wild is 4 years (Pflieger, 1975).

Range lifespan

Status: wild:
unknown to unknown years.

Average lifespan

Status: wild:
4 years.

Range lifespan

Status: captivity:
unknown (low) hours.

Average lifespan

Status: captivity:
4 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Spawns in spring in Wisconsin and Illinois. Eggs hatch in 5-6 days at 19-20 C.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

There have been different ideas proposed about how pirate perch spawn. It is now believed that pirate perch spawn in underwater root masses and use their forward facing urogenital pores to deposit eggs and release sperm into the floating canopy. Recent research (from about 2004) strongly implies that the eggs are deposited and/or fertilized during multiple spawning events.

Male pirate perch guard nests from other males wishing to fertilize the eggs. These behaviors are aggressive and probably relate to pressures and competition for fertilization success in group spawning.

Mating System: polygynandrous (promiscuous)

Spawning generally occurs in May in floating root masses. Female clutch size is about 100-400, depending on body size. In a single root mass up to 2000 total offspring were found to be present in a single nest. Female pirate perch thrust their heads and release their eggs into the root masses and males gather there to fertilize them.

Breeding interval: Breeding occurs once yearly.

Breeding season: Spawning occurs during the spring.

Range number of offspring: 100 to 400.

Key Reproductive Features: iteroparous ; seasonal breeding ; sexual ; fertilization (External ); broadcast (group) spawning; oviparous

The extent of parental involvement in the rearing of pirate perch is debated. Some sources suggest that parents guard the nest until the larvae are a little less than a centimeter long. However more recent papers suggest that there is no evidence of extended parental care.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female)

  • Katula, R. 1992. The Spawning Mode of the Pirate Perch. Trop. Fish Hobby, 40: 156-159.
  • Forbes, S., R. Richardson. 1920. Fishes of Illinois. Springfield, IL: Illinois State Journal Co., State Printers.
  • Fletcher, D., E. Dakin, B. Porter, J. Avise. 2004. Spawning Behavior and Genetic Parentage in the Pirate Perch (Aphredoderus sayanus), a Fish with an Enigmatic Reproductive Morphology.. Copeia, 1: 1-10.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

It was first suggested that the migration of the anus in A. sayanus was to facilitate gill brooding of its eggs, as is found in northern cavefishes (Amblyopsis spelaea) with similar morphological features. However it was noted that the space within the branchial cavity of A. sayanus is insufficient to hold an entire clutch of eggs (Katula, 1992). Pirate perch actually spawn in underwater root masses and use their forward facing urogenital pores to deposit eggs and release sperm into the floating canopy (Fletcher et al., 2004). Fletcher (2004) observed that, within an assemblage, pirate perch were often of distinct developmental stages, strongly implying that the eggs had been deposited and/or fertilized during multiple spawning events.

Male pirate perch guard nests from other males wishing to fertilize the eggs. These behaviors are aggressive and probably relate to selection pressures imposed by intense competition for fertilization success in group spawning (Fletcher et al., 2004).

Mating System: polygynandrous (promiscuous)

Spawning generally occurs in May in floating root masses parallel to water flow. Female clutch size is about 100-400, depending on body size; in a single root mass, up to 2000 total offspring were found to be present in a single nest. Female pirate perch thrust their heads and release their eggs into the root masses and males congregate there to fertilize them (Fletcher et al., 2004).

Breeding interval: Breeding occurs once yearly.

Breeding season: Spawning occurs during the spring.

Range number of offspring: 100 to 400.

Key Reproductive Features: iteroparous ; seasonal breeding ; sexual ; fertilization (External ); broadcast (group) spawning; oviparous

The extent of parental involvement in the rearing of pirate perch is debated. Some sources suggest that parents guard the nest until the larvae are a little less than a centimeter long (Forbes and Richardson, 1920). However, more recent papers suggest that there is no evidence of extended parental care (Fletcher et al., 2004).

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female)

  • Katula, R. 1992. The Spawning Mode of the Pirate Perch. Trop. Fish Hobby, 40: 156-159.
  • Forbes, S., R. Richardson. 1920. Fishes of Illinois. Springfield, IL: Illinois State Journal Co., State Printers.
  • Fletcher, D., E. Dakin, B. Porter, J. Avise. 2004. Spawning Behavior and Genetic Parentage in the Pirate Perch (Aphredoderus sayanus), a Fish with an Enigmatic Reproductive Morphology.. Copeia, 1: 1-10.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aphredoderus sayanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCGCTGATTTTTCTCAACAAACCACAAAGATATTGGCACCCTTTACCTAGTGTTTGGTGCCTGAGCCGGCATAGTTGGCACAGCCCTAAGCCTGTTAATTCGCGCAGAACTAAGCCAACCCGGGGCCCTTTTAGGAGAC---GATCAAATTTATAACGTAATCGTAACAGCCCACGCCTTTGTAATGATTTTCTTCATAGTAATGCCTGTAATAATTGGAGGATTTGGCAACTGACTGGTCCCATTAATAATCGGTGCCCCAGACATAGCCTTTCCTCGAATAAATAACATAAGTTTCTGACTTCTTCCTCCCTCTTTCCTCCTCCTATTAGCCTCATCCGGAGTAGAAGCCGGGGCTGGCACCGGATGAACAGTATACCCACCTTTAGCAGGCAATCTAGCCCACGCAGGCGCCTCCGTAGATTTGACAATCTTCTCCCTACACCTTGCAGGAGCGTCATCTATCCTCGGAGCAATTAACTTTATCACAACTATTATTAACATAAAACCCCCAGCAATTTCGCAATATCAAACCCCACTATTTGTGTGGTCTGTACTAATTACTGCCGTTCTCTTACTACTGTCCCTGCCTGTTCTCGCAGCAGGAATCACAATACTATTAACAGACCGAAACTTAAACACTACATTCTTCGACCCCGCTGGCGGAGGTGACCCAATTCTATACCAACACCTCTTTTGATTCTTTGGCCACCCAGAAGTATACATTCTTATTCTTCCAGGCTTTGGAATAATCTCCCATATCGTTGCCTACTACTCCGGCAAAAAAGAACCTTTTGGCTATATAGGAATAGTCTGAGCAATAATAGCAATTGGCCTTCTAGGCTTTATTGTATGAGCCCACCATATATTTACCGTGGGAATAGACGTAGACACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Aphredoderus sayanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range in eastern and central North America; common in Coastal Plain and other lowlands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large range extent, large number of subpopulations, large population size, apparently stable trend, and lack of major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pirate perch are not generally common because they occupy relatively uncommon habitats. Within those habitats however they are abundant. In one study in Arkansas pirate perch were the most common species found in their sampling. In Ohio pirate perch are considered endangered. Development has significantly impacted the habitats of pirate perch because the bottomland lakes and ponds they occupy have been extensively destroyed by dredging, ditch construction, draining and filling.

IUCN Red List of Threatened Species: no special status

US Federal List: no special status

CITES: no special status

  • Trautman, M. 1957. The Fishes of Ohio. Baltimore, MD: Ohio State University Press.
  • Killgore, K., J. Baker. 1996. Patterns of larval fish abundance in a bottomland hardwood wetland. Wetlands, Vol. 16, no. 3: 288-295.
  • Ohio Division of Wildlife, 2000. "Ohio Biological Survey" (On-line). Biodiversity in Ohio. Accessed December 07, 2005 at http://www.ohiobiologicalsurvey.org/biodiv-v6n2.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pirate perch are not generally common because they occupy relatively uncommon habitats. Within those habitats however they are abundant. In one study in Arkansas pirate perch were the most common species found in their sampling, representing 21% of 8,113 fish taken (Killgore and Baker, 1996). In Ohio pirate perch are considered endangered. Development has significantly impacted the habitats of pirate perch because the bottomland lakes and ponds they occupy have been extensively destroyed by dredging, ditch construction, draining and siltation (Trautman, 1957).

US Federal List: no special status

CITES: no special status

  • Trautman, M. 1957. The Fishes of Ohio. Baltimore, MD: Ohio State University Press.
  • Killgore, K., J. Baker. 1996. Patterns of larval fish abundance in a bottomland hardwood wetland. Wetlands, Vol. 16, no. 3: 288-295.
  • Ohio Division of Wildlife, 2000. "Ohio Biological Survey" (On-line). Biodiversity in Ohio. Accessed December 07, 2005 at http://www.ohiobiologicalsurvey.org/biodiv-v6n2.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Trend over the past 10 years or three generations is uncertain but probably relatively stable.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is represented by a large number of occurrences (subpopulations) (e.g., see map in Lee et al. 1980).

Total adult population size is unknown but presumably exceeds 100,000. This fish is very common in suitable habitat in much of its range.

Trend over the past 10 years or three generations is uncertain but probably relatively stable.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: No major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
No major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research actions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known negative impacts of pirate perch on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Pirate perch are not widely used as food or recognized as game fish.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known negative impacts of pirate perch on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Pirate perch are not widely used as food or recognized as game fish.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pirate perch

The pirate perch, Aphredoderus sayanus, is a freshwater fish of the Percopsiformes order. This small fish (up to 14 cm (5.5 in) in total length) is native to the eastern half of North America. It is dark brown, sometimes with a darker band near the base of the tail. A unique feature of this fish is the forward placement of its cloaca, under the head, anterior to the pelvic fins.[1] This placement allows the females to place their eggs more precisely into root masses.

Pirate perch may be the only known animals to exhibit chemical camouflage, or crypsis.[2]

Its preferred habitat is backwaters of warm water with little current. The fish was named by Charles C. Abbott because he observed it eating only other fishes.

The pirate perch is related to the trout-perches, but only loosely; it is, for example, the only species in its family: Aphredoderidae. The specific name sayanus is a tribute to naturalist Thomas Say.

The pirate perch is a freshwater fish commonly inhabiting coastal waters along the east coast of the United States and the backwater areas of the Mississippi Valley.[3] This species is often found towards the bottom of clear, warm water habitats with low currents. These fish are normally solitary, carnivorous, and nocturnal. The pirate perch is known to consume live mosquito larva, amphipods, glass shrimp, meal worms, small fish, dragonfly and stonefly larvae, and earthworms.[4] This species' method of breeding was misunderstood for quite some time due to difficulties in making in situ observations.[3] At first, the urogenital positioning of the pirate perch was speculated to serve to promote egg transfer to the fish's branchial chamber for gill-brooding.[5] However, the pirate perch was found to not breed bronchially; instead, they lay their eggs within underwater root masses which are then fertilized by the males.[5][6] While the pirate perch is not an endangered species, it is uncommon due to its habitats and time of activity.

Distribution[edit]

A. sayanus is a freshwater species in temperate climates with a temperature ranging from 5–26̊C. They are found most commonly in central and eastern North America. The pirate perch occurs in rivers of the Atlantic and Gulf slopes, the Mississippi Valley, and scattered parts of the eastern Great Lakes Basin.[7] Pirate perch had once occurred in Pennsylvania, but has since been extirpated due to the effects of urbanization, according to the Nature Conservancy. Its geographic range is very limited in the United States, and the creation of dams and the increasing effects of urbanization are restricting the overall habitat size for the fish, which could eventually lead to this species becoming extirpated in some areas.

Ecology[edit]

These fish can be found in densely vegetated areas, places with woody debris, and underneath banks in root masses. Debris in deep water with undercut banks and slow inside flows are used more by this species. The area where the perch reside is dependent on their size, with medium to large perch occupying places that were more structurally complex than small ones. They are known to congregate in these areas to avoid predation from piscivorous birds, otters, or mink.[5] The pirate perch has nocturnal feeding habits; their diet consists of live mosquito larva, amphipods, glass shrimp, meal worms, small fish, dragonfly and stonefly larvae, and earthworms.[4]

Life history[edit]

Breeding occurs from October to December in Florida[8] and in Louisiana as early as February.[6] Most breeding occurs around early April until May, depending on latitude.[5] When breeding, pirate perch use underwater root masses as the microhabitat for their larvae. Females have been observed thrusting their heads into sheltered canals of underwater root masses and releasing eggs. The male perch then come to these sites, enter the canal head-first, and proceed to fertilize the eggs in the same manner they were laid.[5] Females can lay between 100 and 400 eggs, which is dependent on the body size. They are able to reproduce after one year, and can live up to four years in the wild.[9]

Current management[edit]

According to the Iowa Department of Natural Resources, some major threats that could affect their habitats could be siltation due to poor upland treatment. Since these fish reside in habitats with slight water current, a change upstream such as water channels, dams, or drainages could alter the flow of water in that system, which could change the rate at which water flows downstream. Water pollution as a result from agricultural runoff and discharge from urban areas can create environments unsuitable for these species. Ohio has expressed some interest in conserving the species due to the perch having such a small area it can inhabit in the northwestern part of the state. Besides Ohio, little concern has been shown about this species overall.

References[edit]

  1. ^ Cohen, Daniel M. (1998). Paxton, J.R. & Eschmeyer, W.N., ed. Encyclopedia of Fishes. San Diego: Academic Press. p. 129. ISBN 0-12-547665-5. 
  2. ^ Resetarits, Jr., William J.; Binckley, Christopher A. (2013). "Is the pirate really a ghost? Evidence for generalized chemical camouflage in an aquatic predator, pirate perch Aphredoderus sayanus". The American Naturalist 181 (5): 690-699. doi:10.1086/670016. Archived from the original on May 31, 2013. 
  3. ^ a b Boltz,J.M., and J.R. Stauffer Jr. 1986. Branchial brooding in the pirate perch, Aphredoderus sayanus(Gilliams). Copeia 1986:1030-1031.
  4. ^ a b Parker, N.C., and B.A. Simco. 1975. Activity patterns, feeding and behavior of the Pirate Perch,Aphredoderus sayanus. Copeia 1975:572-574.
  5. ^ a b c d e Fletcher, D. E., E. E. Dakin, B. A. Porter, and J. C. Avise. 2004. Spawning behavior and genetic parentage in the pirate perch (Aphredoderus sayanus), a fish with an enigmatic reproductive morphology. Copeia 2004:1–10.
  6. ^ a b Fontenot, Q. C. and D. A. Rutherford. 1999. Observations on the reproductive ecology of pirate perch Aphredoderus sayanus. Journal of Freshwater Ecology 14:545–549.
  7. ^ Boltz,J.M., and J.R. Stauffer Jr. 1993. Systematics of Aphredoderus sayanus (Teleostei: Aphredoderidae). Copeia 1993:81-98.
  8. ^ McLane, W.M. 1955. The fishes of the St. Johns River system. Ph.D. dissertation, University of Florida, 361 pp.
  9. ^ Pflieger, W'. 1975. The Fishes of Missouri. Missouri: Missouri Department of Conservation.
  • Froese, Rainer, and Daniel Pauly, eds. (2006). "Aphredoderidae" in FishBase. May 2006 version.
  • Froese, Rainer, and Daniel Pauly, eds. (2006). Species of Aphredoderus in FishBase. May 2006 version.
  • Froese, Rainer and Pauly, Daniel, eds. (2006). "Aphredoderus sayanus" in FishBase. May 2006 version.
  • Abbott, C. C. (1861), Notes on the habits of Aphredoderus sayanus. Proc. Acad. Nat. Sci. Phila:95-96.
  • Brill, J. S. (1977), Notes on abortive spawning of the Pirate Perch, "Aphredoderus seyanus", with comments on sexual distinctions. Am. Curr 5:10-16.
  • Fletcher, Dean E. (2004), Spawning Behavior and Genetic Parentage in the Pirate Perch ("Aphredoderus sayanus"), a Fish with an Enigmatic Reproductive Morphology. Copeia: 1-10.
  • Katula, R. S. (1987), Spawning of the Pirtae Perch recollected. Am. Curr 20: 9.
  • Martin, F. D. and C. Hubbs (1973), Observations on the development of Pirate Perch, "Aphredoderus sayanus", with comments on sexual distinctions. Ibid: 377-379.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The only living member of the family. Includes two valid subspecies, Atlantic slope sayanus and western gibbosus (Boltz and Stauffer 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!