Overview

Brief Summary

Astronotus ocellatus is a species of fish from the cichlid family, originally described by Louis Agassiz in 1831, although he mistakenly classified it in the marine genus Lobotes. The largest of the new world cichlids, they can live 10-20 years and reach up to a maximum length of 45cm (18 inches) long, although they are most commonly found 25-30 cm (10-12 inches) in length and 1.6 kilograms (3.5 lb) in weight. A popular aquarium fish, Astronotus ocellatus has many common names, including oscar, tiger oscar, velvet cichlid, or marble cichlid, which reflect a number of bred ornamental varieties, including long-finned varieties and various color morphs. Oscars are native to the Amazon river basin, especially shallow, quiet floodplains and swamps. Native oscars usually show characteristic orange ringed, bilateral ocelli (eyespots) at the base of their tail which have been shown to dissuade predators and also function in sexual selection, as these fish are very visually oriented. Suction feeders, A. ocellatus are omnivorous, eating invertebrates such as flies, worms, crayfish, some small fish, fruit that falls into water, and large oscars will even eat small vertebrates, such as mice. Oscars are an esteemed food species in South America, although not commonly eaten elsewhere, as they grow too slowly for aquaculture. Escaped ornamentals and individuals purposely introduced into waterways have established wild populations in Asia, China and North America.

(Beeching, 1995; Froese 2011; Griffioen 1999; Nico and Fuller 2012; Robbins; Wikipedia 2012; Winemiller 1990)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Preferably inhabits quiet shallow waters in mud-bottomed and sand-bottomed canals and ponds (Ref. 5723). Feeds on small fish, crayfish, worms and insect larvae. Quite popular with aquarists but not for aquaculturists because of its slow growth (Ref. 35237). Maximum length 40 cm TL (Ref. 5723). A highly esteemed food fish in South America (Ref. 44091).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

These fish are found in the Amazon River basin, from the Orinoco River to the Rio Paraguay, throughout Venezuela, Guyana, and Paraguay. (The Aquarium Encyclopedia, 1983.)

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Native to Orinoco, Amazon, and La Plata river basins, South America. Established in Hawaii and southern Florida. Has been collected in Pennsylvania, Massachusetts, Maine, and Rhode Island. Introductions are due to fish farm and aquarium fish releases.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

South America: Amazon River basin in Peru, Colombia and Brazil; French Guiana. Reported from Argentina (Ref. 9086).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Compared to other fishes, Astronotus ocellatus has a slender, laterally compressed body, and a blunt head with a large mouth and protruding jaw. Colors vary greatly among geographic regions and individuals, but most are dark green to black, with red stripes along its back and a red circle on the base of the tail fin. The adult fish grows up to 35 cm long. Males and females are visually indistinguishable. (Gracyalny, 1996.)

Range mass: 2 to 4 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dorsal spines (total): 12 - 14; Dorsal soft rays (total): 19 - 21; Analspines: 3; Analsoft rays: 15 - 17
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 33 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 400 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

45.7 cm TL (male/unsexed; (Ref. 40637)); max. published weight: 1,580 g (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Large mouth with thick lips; 7 preopercular pores; first gill arch without lobe; gill rakers short and thick with many denticles; dorsal and anal fins bases densely scaled; many branched rays; body color dark with bright orange opercle margin and ventral parts of the lateral sides of the body; often a black rounded blotch with orange margin at caudal fin base (Ref. 35237).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Found in the tropical lowlands of South America, A. ocellatus prefers the floodplains and swamps of the Amazon River basin. They are most comfortable in water about 25 degrees Celsius, or slightly higher for breeding. (Kullander, 1996)

Aquatic Biomes: rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Florida: mud- and sand-bottomed canals and ponds (Page and Burr 1991). Eggs are laid on substrate.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

benthopelagic; freshwater; pH range: 6.0 - 8.0; dH range: 5 - 19
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Although these predators are not at all choosy, they feed mostly on insect larvae and smaller fish. Their feeding habits require that Oscars have excellent eyesight. Because of this, they have been the subject of numerous studies concerning eyesight in fish. (The Aquarium Encyclopedia, 1983, Andison and Sivak, 1996)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Preferably inhabits quiet shallow waters in mud-bottomed and sand-bottomed canals and ponds (Ref. 5723). Usually solitary (Ref. 9088). Benthopelagic (Ref. 58302). Feeds on small fish, crayfish, worms and insect larvae, terrestrial invertebrates and aquatic macrophytes (Ref. 9089). Omnivore (Ref. 76754).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

White spot Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Procamallanus Infection 10. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nematode Infection (general). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Intestinal Worm Infection (general). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ichthyobodo Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Goezia Disease 6. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dactylogyrus Gill Flukes Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bacterial Infections (general). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

In captivity, both male and female clean a suitable spawning site - often a flat rock , or branches, or in a circular nest excavated in shallow water (Ref. 44091). Eggs (usually numbering in the thousands, Ref. 44091) are deposited and are guarded by both parents. Egg hatch in 3 or 4 days and parent move the fry to a shallow pit in the sand where they remain for 6 or 7 days (Ref. 7020).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Though they can become much larger, A. ocellatus are sexually mature soon in life, usually by the time they are 12 cm long. These fish exhibit a high degree of parental care. After spawning in open water, the eggs are laid on a piece of ground that has been cleared by one of the parents. After three or four days, the eggs hatch. The brood is then transported to a sandy hollow for about one week. Young fish have been observed clinging to their parents with their mouths, even after they are able to swim freely. (The Aquarium Encyclopedia, 1983)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Spawns June-October at 28-33 C in Florida. Parents incubate eggs and guard young.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Astronotus ocellatus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC3769-07|NC_009058|Astronotus ocellatus| ACACGTTGATTCTTCTCAACTAATCACAAAGACATCGGCACCCTTTATTTAGTATTTGGTGCTTGAGCCGGAATAGTGGGGACCGCACTC---AGCCTACTTATTCGAGCAGAACTAAGCCAACCGGGCTCTCTCCTGGGAGAC---GATCAAATTTATAACGTAATTGTTACTGCCCATGCCTTTGTAATAATTTTCTTTATAGTTATACCCATCATAATCGGAGGCTTTGGAAACTGACTTATTCCCCTAATG---ATTGGAGCTCCAGACATAGCCTTCCCACGAATAAACAACATAAGTTTCTGACTCCTCCCTCCCTCCTTCCTCCTCCTCTTGGCCTCATCAGGTGTTGAAGCTGGTGCTGGAACAGGATGAACTGTTTACCCACCTTTGGCGGGTAACTTAGCACACGCTGGCCCATCCGTTGATCTA---ACTATTTTTTCACTACACTTAGCCGGTGTATCCTCAATTCTTGGGGCAATTAACTTCATCACTACAATCATTAATATAAAACCCCCAGCCGTCTCTCAATACCAAACACCCCTATTTGTATGAGCCCTTCTTATCACTGCCGTACTTCTCCTGCTTTCCCTCCCCGTTCTCGCTGCT---GGCATCACTATACTTTTAACTGACCGCAATCTGAACACAACCTTCTTCGATCCAGCAGGAGGAGGAGACCCCATTCTTTATCAACACCTATTCTGATTCTTTGGCCACCCAGAAGTTTACATTCTAATCCTTCCAGGATTTGGGATAATTTCCCACATTGTTGCGTACTATGCTGGTAAAAAA---GAACCCTTTGGATTTATAGGAATAGTCTGGGCCATAGTCTCTATCGGCTTCCTAGGCTTTATTGTTTGAGCCCATCACATATTTACTGTTGGGATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Astronotus ocellatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Species: 11
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

---

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

As a popular aquarium fish, A ocellatus has some obvious economic importance to humans. Additionally, it has been used by biologists in numerous studies of fish, including studies on behavior, eyesight, auditory systems, and swim bladders.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

fisheries: commercial; gamefish: yes; aquarium: highly commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Oscar (fish)

Astronotus ocellatus is a species of fish from the cichlid family known under a variety of common names, including oscar, tiger oscar, velvet cichlid, or marble cichlid.[1] In South America, where the species naturally resides, A. ocellatus specimens are often found for sale as a food fish in the local markets.[2][3] The fish can also be found in other areas, including China, Australia, and the United States. Although its slow growth limits its potential for aquaculture, it is considered a popular aquarium fish.[4][5][6]

Contents

Taxonomy

The species was originally described by Louis Agassiz in 1831 as Lobotes ocellatus, as he mistakenly believed the species was marine; later work assigned the species to the genus Astronotus.[7] The species also has a number of junior synonyms: Acara compressus, Acara hyposticta, Astronotus ocellatus zebra, and Astronotus orbiculatus.[8]

Description

Ocelli on dorsal fin and caudal peduncle

A. ocellatus examples have been reported to grow to about 45 cm (18 in) in length and 1.6 kilograms (3.5 lb) in weight.[1] The wild-caught forms of the species are typically darkly coloured with orange-ringed spots or ocelli on the caudal peduncle and on the dorsal fin.[5] These ocelli have been suggested to function to limit fin-nipping by piranha (Serrasalmus spp.), which co-occur with A. ocellatus in its natural environment.[7][9] The species is also able to rapidly alter its colouration, a trait which facilitates ritualised territorial and combat behaviours amongst conspecifics.[10] Juvenile oscars have a different colouration from adults, and are striped with white and orange wavy bands and have spotted heads.[7]

Distribution and habitat

Two tiger oscars

A. ocellatus is native to Peru, Ecuador, Colombia, Brazil, and French Guiana, and occurs in the Amazon river basin, along the Amazonas, Içá, Negro, Solimões, and Ucayali river systems, and also in the Approuague and Oyapock drainages.[1][2] In its natural environment, the species typically occurs in slow-moving white-water habitats, and has been observed sheltering under submerged branches.[5] Feral populations also occur in China,[11] northern Australia,[12] and Florida, USA[13] as a by-product of the ornamental fish trade. The species is limited in its distribution by its intolerance of cooler water temperatures, the lower lethal limit for the species is 12.9 °C (55.2 °F).[14]

Sexual dimorphism

Although the species is widely regarded as sexually monomorphic,[5] males have been suggested to grow more quickly, and in some naturally occurring strains, males are noted to possess dark blotches on the base of the dorsal fin.[6][7] The species reaches sexual maturity at approximately one year of age, and continues to reproduce for nine to ten years. Frequency and timing of spawning may be related to the occurrence of rain.[15] A. ocellatus fish are biparental substrate spawners, though detailed information regarding their reproduction in the wild is scarce.

Young oscar, about 2 inches

The closely related Astronotus crassipinnis has been observed, in times of danger, to store food in its mouth, possibly for protection, in a manner reminiscent of mouthbrooding geophagine cichlids. This behaviour, however, has not yet been observed in A. ocellatus.[6] In captivity, pairs are known to select and clean generally flattened horizontal or vertical surfaces on which to lay their 1,000 to 3,000 eggs. Like most cichlids, A. ocellatus practices brood care, although the duration of brood care in the wild remains unknown.[6]

Feeding

Captive oscars may be fed prepared fish food designed for large carnivorous fish, crayfish, worms, and insects (such as flies or grasshoppers). They even eat small mice, and crickets are also good live food. Its feeding habits mostly depends on live food so feeding with live food may increase the rate of growth but also may cause endoparasites. Since these fish eat fruit in the wild, it can also be used as a type of food. Just about anything that fell into the water would be eaten by oscars. Live feeder fish can be given, but fish such as goldfish and rosy red feeder minnows should not be fed. They also contain an enzyme within their flesh which binds vitamin B1, leading to deficiency. Most fish eaten by A. ocellatus in the wild are relatively sedentary catfish, including Bunocephalus, Rineloricaria, and Ochmacanthus species.[9] The species uses a suction mechanism to capture prey,[16] and has been reported to exhibit "laying-on-side" death mimicry in a similar fashion to Parachromis friedrichsthalii and Nimbochromis livingstonii.[17][18] The species also has an absolute requirement for vitamin C, and develops health problems in its absence.[19]

Selective breeding

A leucistic long-finned oscar

A number of ornamental varieties of A. ocellatus have been developed for the aquarium industry. These include forms with greater intensity and quantities of red marbling across the body, albino, leucistic, and xanthistic forms. A. ocellatus with marbled patches of red pigmentation are sold as red tiger oscars, while those strains with mainly red colouration of the flanks are frequently sold under the trade name of red oscars.[20] The patterning of red pigment differs between individuals; in the United Kingdom, one A. ocellatus reportedly had markings that resembled the Arabic word for "Allah".[21] In recent years long-finned varieties have also been developed. The species is also occasionally artificially coloured by a process known as painting.[22]

References

  1. ^ a b c Froese, R. and D. Pauly. Editors.. "Astronotus ocellatus, Oscar". FishBase. http://filaman.uni-kiel.de/summary/SpeciesSummary.php?id=3612. Retrieved 2007-03-16. 
  2. ^ a b Kullander SO.. "Cichlids: Astronotus ocellatus". Swedish Museum of Natural History. http://www2.nrm.se/ve/pisces/acara/as_ocell.shtml. Retrieved 2007-03-16. 
  3. ^ Kohler, CC et al.. "Aquaculture Crsp 22nd Annual Technical Report". Oregon State University, USA. http://pdacrsp.oregonstate.edu/pubs/technical/22tch/03-11SDFR1.pdf. Retrieved 2007-03-16. 
  4. ^ Keith, P. O-Y. Le Bail & P. Planquette, (2000) Atlas des poissons d'eau douce de Guyane (tome 2, fascicule I). Publications scientifiques du Muséum national d'Histoire naturelle, Paris, France. p. 286
  5. ^ a b c d Staeck, Wolfgang; Linke, Horst (1995). American Cichlids II: Large Cichlids: A Handbook for Their Identification, Care, and Breeding. Germany: Tetra Press. ISBN 1-56465-169-X. 
  6. ^ a b c d Loiselle, Paul V. (1995). The Cichlid Aquarium. Germany: Tetra Press. ISBN 1-56465-146-0. 
  7. ^ a b c d Robert H. Robins. "Oscar". Florida Museum of Natural History. http://www.flmnh.ufl.edu/fish/Gallery/Descript/oscar/oscar.html. Retrieved 2007-03-18. 
  8. ^ Froese, R. and D. Pauly. Editors.. "Synonyms of Astronotus ocellatus". FishBase. http://filaman.uni-kiel.de/Nomenclature/SynonymsList.cfm?ID=3612&GenusName=Astronotus&SpeciesName=ocellatus. Retrieved 2007-03-21. [dead link]
  9. ^ a b Winemiller KO (1990). "Caudal eye spots as deterrents against fin predation in the neotropical cichlid Astronotus ocellatus". Copeia 3: 665–673. http://wfsc.tamu.edu/winemiller/lab/W-eyespots-Copeia90.pdf. 
  10. ^ Beeching, SC (1995). "Colour pattern and inhibition of aggression in the cichlid fish Astronotus ocellatus". Journal of Fish Biology 47: 50. doi:10.1111/j.1095-8649.1995.tb01872.x. 
  11. ^ Ma, X.; Bangxi, X.; Yindong, W. and Mingxue, W. (2003). "Intentionally Introduced and Transferred Fishes in China’s Inland Waters". Asian Fisheries Science 16: 279–290. 
  12. ^ Department of primary industry and fisheries.. "Noxious fish – species information". Queensland Government, Australia. Archived from the original on 2007-08-29. http://web.archive.org/web/20070829180030/http://www2.dpi.qld.gov.au/fishweb/14477.html. Retrieved 2007-03-16. 
  13. ^ United States Geological Survey.. "NAS – Species FactSheet Astronotus ocellatus (Agassiz 1831)". United States Government. http://nas.er.usgs.gov/queries/FactSheet.asp?speciesID=436. Retrieved 2007-03-17. 
  14. ^ Shafland, P. L. and J. M. Pestrak (1982). "Lower lethal temperatures for fourteen non-native fishes in Florida". Environmental Biology of Fishes 7 (2): 139–156. doi:10.1007/BF00001785. 
  15. ^ Pinto Paiva, M and Nepomuceno, FH (1989). "On the reproduction in captivity of the oscar, Astronotus ocellatus (Cuvier), according to the mating methods (Pisces – Cichlidae)". Amazoniana 10: 361–377. 
  16. ^ Waltzek,TB and Wainwright, PC (2003). "Functional morphology of extreme jaw protrusion in Neotropical cichlids". Journal of Morphology 257 (1): 96–106. doi:10.1002/jmor.10111. PMID 12740901. 
  17. ^ Tobler, M. (2005). "Feigning death in the Central American cichlid Parachromis friedrichsthalii". Journal of Fish Biology 66 (3): 877–881. doi:10.1111/j.0022-1112.2005.00648.x. 
  18. ^ Gibran,FZ. (2004). Armbruster, J. W.. ed. "Dying or illness feigning: An unreported feeding tactic of the Comb grouper Mycteroperca acutirostris (Serranidae) from the Southwest Atlantic". Copeia 2004 (2): 403–405. doi:10.1643/CI-03-200R1. JSTOR 1448579. 
  19. ^ Fracalossi, DM; Allen, ME; Nicholsdagger, DK and Oftedal, OT (1998). "Oscars, Astronotus ocellatus, Have a Dietary Requirement for Vitamin C". The Journal of Nutrition 128 (10): 1745–1751. PMID 9772145. 
  20. ^ Sandford, Gina; Crow, Richard (1991). The Manual of Tank Busters. USA: Tetra Press. ISBN 3-89356-041-6. 
  21. ^ BBC News (2006-01-31). "Tropical fish 'has Allah marking'". BBC, UK. http://news.bbc.co.uk/2/hi/uk_news/england/lancashire/4667610.stm. Retrieved 2007-03-18. 
  22. ^ Mike Giangrasso. "Death by Dyeing – dyed fish list". Death by Dyeing.org. http://www.deathbydyeing.org/colormedead.htm. Retrieved 2007-03-18. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!