Overview

Brief Summary

Biology

The sandbar shark spends the majority of its time near the sea bottom, where it patrols continuously for prey (4), such as small bottom-dwelling fishes, molluscs and crustaceans (2). Whilst the diet of the adult consists primarily of fish, the pups appear to feed more on soft blue crabs (7). Despite its size and large triangular teeth, the sandbar shark has never been blamed for attacks on humans, preferring instead to stick to its live fish meals (2). Like most other members of the Carcharhinidae family, the sandbar shark is viviparous, giving birth to between 1 and 14 pups in each litter (2). The size of the litter varies depending on the size of the mother, with large females giving birth to larger litters (2). Pregnancy is estimated to last from 8 to 12 months (2), and appears to differ between geographical locations (8) (9). The time of year in which the pups are born also varies slightly, but all females move inshore to shallow nursery areas to give birth (2) (8) (9). These nursery grounds are separated from the normal ranges of adults (9), and presumably offer the young a calm, food-rich environment in which to begin their lives. The females leave these coastal areas soon after giving birth, while the young remain in the nursery grounds until winter (9), when they move into warmer and deeper water (2). A common feature of sharks is their slow growth rate and low reproductive output. Estimates of the age at which the sandbar shark matures range from eight to ten years in Hawaii (10), to between 12 and 15 years of age in the Northwest Atlantic Ocean (11). Females give birth every other year at most (2). Populations of sandbar sharks appear to segregate by age (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The most distinctive feature of this stocky, grey shark is its huge dorsal fin (3) (4), which increases its stability as it cruises the sea bottom in coastal areas. The sandbar shark belongs to the genus Carcharhinus, a word derived from the Greek “karcharos” meaning sharpen and “rhinos” meaning nose (3), although this species has a fairly rounded snout (2). The species name plumbeus comes for a Latin word meaning 'of lead' (3), presumably referring to its colouration, which is bluish to brownish-grey on the back, and lighter, or whitish, on the underside (2) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Found inshore and offshore, on continental and insular shelves and adjacent deep water (Ref. 244). Common at bays, river mouths and in harbors; avoids sandy beaches and the surf zone, coral reefs and rough bottom, and surface waters (Ref. 244). Coastal-pelagic, but usually bottom associated at 1-280 m (Ref. 58302). Sometimes in oceanic waters (Ref. 9997). Known to make extended seasonal migrations in some parts of its range (Ref. 6871). Feeds mainly on bony fishes, also small sharks, cephalopods, and shrimps (Ref. 5578), rays and gastropods (Ref. 5213). Viviparous (Ref. 50449). Sexual dimorphism is evident in thickness of skin layer of maturing and adult females (Ref. 49562). Populations are segregated by age. Young readily kept in aquaria (Ref. 244). Utilized for human consumption, for leather and oil (Ref. 244). Marketed fresh, smoked, dried-salted and frozen; fins are valued for soup (Ref. 9987). Used in Chinese medicine (Ref. 12166). Records to 300 cm TL uncertain (Ref. 9997). TL to 300 cm (Ref. 26938). Angling: an inshore fish and a good light-tackle fighter (Ref. 84357).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: shark (English), tiburón (Espanol)
 
Carcharhinus plumbeus (Nardo,1827)


Sandbar shark


Body stout; snout round, short (length 0.9-1.3 in distance between nostrils); eyes small; nasal opening small and well separated; nasal flaps low, broadly triangular; upper front teeth broadly triangular, finely serrated, lower front teeth with narrow, straight points; 5 gill slits, last 2 over pectoral fin base; first dorsal very high, triangular, origin over rear of base of pectoral; origin of second dorsal over anal origin;  pectoral long, wide, curved, tip pointed to rounded; prominent crest between dorsal fins; tail fin strongly asymmetrical, with well developed lower lobe, undulating ridge along dorsal surface of top lobe, and a ventral notch near tip of that lobe; notch on top of tail base.

Bronze to grey above, belly whitish.

Size: 250 cm.

Habitat: inshore and offshore, coastal pelagic, demersal over sandy and muddy bottoms, bay mouths, river mouths.

Depth: 0-1800 m.

Circumtropical; there are reports from the Galapagos and the Revillagigedos; however there are no known specimens from our region.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Djibouti, Eritrea, European waters (ERMS scope), Greek Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, Israeli part of the Mediterranean Sea - Eastern Basin, Madagascar, Mauritius, Mozambique, North West Atlantic, Portuguese Exclusive Economic Zone, Red Sea, Reunion, Seychelles, Somalia, South Africa (country), Spanish Exclusive Economic Zone, Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: southern Massachusetts, USA to Argentina (Ref. 58839); also Gulf of Mexico, Bahamas, Cuba and south and west Caribbean (Ref. 26938). Eastern Atlantic: Portugal to Democratic Republic of the Congo, including the Mediterranean. Indo-Pacific: scattered records ranging from the Red Sea, Persian Gulf and East Africa to the Hawaiian Islands. Eastern Pacific: Revillagigedo and Galapagos islands (Ref. 28023).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species occurs world-wide in tropical and warm temperate waters.

Western Atlantic: USA from Gulf of Maine, Massachusetts to Yucatan, Mexico, Cuba and Bahamas; possibly to Belize, Honduras, Costa Rica, Panama, Columbia, Trinidad and Tobago and Venezuela; southern population extending from southern Brazil to northern Argentina (Compagno in prep).

Eastern Atlantic: Portugal, possibly Canary Islands, Spain, Morocco, Senegal, Cape Verde Islands, Guinea, Guinea Bissau, Liberia, Ivory Coast, Ghana, Benin, Togo, Nigeria, Cameroon, Equatorial Guinea, Gabon, Congo, Zaire, Sao Tome and Principe (Compagno in prep).

Mediterranean Sea: Corsica, Egypt, Greece, Israel, Italy, Croatia, Slovenia, Lebanon, Libya, Malta, Spain, Syria, Tunisia and Turkey (Compagno in prep.).

Western Indian Ocean: South Africa, Madagascar, Mozambique, Tanzania, Mauritius, Seychelles, Red Sea, Gulf of Oman (Compagno in prep).

Western Pacific: Viet Nam, China (including Taiwan Province), Japan, Indonesia (Aru Island), Australia (Queensland, New South Wales), New Caledonia (Compagno in prep).

Eastern Indian Ocean: Western Australia and the Northern Territory (Compagno in prep).

Also common in the Hawaiian Islands in the Central Pacific (Compagno in prep). Records from Galapagos and Revillagigedo Islands are probably spurious.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Sandbar sharks are found worldwide in tropical and warm temperate waters. These sharks can be found in the western Atlantic, the eastern Atlantic, the western Pacific, the western Indian, and the eastern Indian oceans. They may also be found in the Caribbean, Gulf of Mexico, and the Mediterranean Sea. Important areas for juveniles in United States include Cape Cod, Massachusetts; Cape Canaveral, Florida; Bulls Bay, South Carolina; Delaware Bay, New Jersey; the Chesapeake Bay, and the Eastern Shore of Virginia.

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native ); mediterranean sea (Native )

Other Geographic Terms: cosmopolitan

  • 2009. "International Union for Conservation of Nature and Natural Resources" (On-line). The IUCN Red List of Threatened Species - Carcharhinus Plumbeus. Accessed February 03, 2010 at http://www.iucnredlist.org/apps/redlist/details/3853/0.
  • Carlson, J. 1999. Occurrence of Neonate and Juvenile Sandbar Sharks, Carcharhinus plumbeus, in the Northeastern Gulf of Mexico. Fishery Bulletin, 97: 387-391.
  • Compagno, L., M. Dando, S. Fowler. 2005. Sharks of the World. Princeton: Princeton University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Massachusetts (Woods Hole, straying into Gulf of Maine) to southern Brazil
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in tropical through warm temperate seas (including Mediterranean Sea, Red Sea, Madagascar, Mascarenes, Hawaiian Islands); possibly absent from eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 1800 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East), East Pacific + Atlantic (East +/or West), Transisthmian (East Pacific + Atlantic of Central America), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Island (s), Island (s) only

Residency: Vagrant

Climate Zone: Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Occurs in temperate and tropical waters, in the Western Atlantic, from Massachusetts to southern Brazil; in the eastern Atlantic from Portugal to Zaire; and in the Indo-Pacific from South Africa to the Galapagos and from Vietnam to New Caledonia. It also occurs in the Red Sea and Mediterranean (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Sandbar sharks are generally a grey-brown color or “bronzy,” as Compagno, et al. (2005) described. They have white undersides and dusky posterior edges to their fins. They also have an “inconspicuous” white band on their flank. Compagno et al. (2005) described them as having a “moderately long rounded snout” and “high triangular saw-edged upper teeth.” Their first dorsal fins are especially large compared to other sharks. As newborns, these sharks are about 56 to 75 cm total length (TL). At maturity they reach 140 to 180 cm total length and as adults they reach 240 to 300 cm total length. These sizes may vary depending on location.

Range mass: 45 to 90 kg.

Range length: 240 to 300 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 250.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 2500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

250 cm TL (male/unsexed; (Ref. 11070)); max. published weight: 117.9 kg (Ref. 4699); max. reported age: 34 years (Ref. 92315)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum Length : 250 cm
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

A stout shark with a moderately long, rounded snout, high, triangular, saw-edged upper teeth, and an interdorsal ridge; 1st dorsal fin very large and erect (Ref. 5578). Grey-brown or bronzy with no prominent markings, white below (Ref. 5578). Fins plain or with slightly dusky tips (Ref. 5485).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Found over sandy and muddy areas of coastal waters, including estuaries. May inhabit oceanic waters. Feeds on benthic animals, fishes, rays, gastropods, and squids (Ref. 5213). Viviparous; litter size 1-14 pups, born during midsummer (Ref. 5485); 56-75 cm at birth (Ref. 2334). Populations are segregated by age. Preferred water tempeatures range from 23 to 27°C. Potentially dangerous but has never been incriminated in any attack on people. Utilized for human consumption, for leather and oil. Marketed fresh, dried-salted and frozen; fins are valued for soup (Ref. 9987).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; oceanodromous (Ref. 51243); brackish; marine; depth range 1 - 280 m (Ref. 58302), usually 20 - 65 m (Ref. 55188)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
C. plumbeus occurs inshore and offshore. It is a coastal-pelagic shark of temperate and tropical waters, found on continental and insular shelves and in deep water adjacent to them, and oceanic banks. It is also common at bay mouths, in harbours, inside shallow muddy or sandy bays, and at river mouths, but tends to avoid sandy beaches and the surf zone, coral reefs and rough bottom, and the surface. Depths range from the intertidal in water barely deep enough to cover it to 280 m. Although common in inshore environments, it does not ascend rivers into fresh water. It favours the bottom, and normally is not seen at the surface unless travelling in water so shallow that its large first dorsal fin comes out of the water. This species has an annual migration cycle along the Western North Atlantic seaboard of the United States, heading south for the winter and north for the summer. Seasonal temperature changes apparently are a prime cause of these migrations, but they are strongly influenced by the pattern of currents and locally by upwelling. Southward-migrating sharks often travel in large schools. In the Western North Atlantic pupping grounds are in temperate waters, in shallow bays and estuaries of the east-central USA. The sandbar shark is primarily a predator on relatively small bottom fishes, with some molluscs and crustaceans taken. It does not consume garbage and mammalian carrion as a rule, unlike some other members of its genus (Compagno 1984).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The below is mainly taken from Musick (2005), with some information updated.

Carcharhinus plumbeus is a coastal shark, often in shallow waters associated with sandy or muddy flats, bays, estuaries and harbours commonly down to salinities of 20 ppt in some populations (Grubbs et al. 2007a) and also further offshore, particularly on banks, near islands, flat reefs and other topographic features in open waters (Compagno in prep.). This species occurs from the surfline down to 280 m (Compagno in prep.), but typically in waters less than 100 m where it frequently forages near the seabed. In the Mediterranean it is caught down to 200 m (caught at this depth on the bottom in Sicilian waters by trawlers) (Compagno in prep.). Juveniles tend to occur in offshore temperate waters, while larger sharks mainly occur in tropical waters (McAuley et al. 2005).

This species is viviparous with a yolk sac placenta. Gestation has been estimated at 9?12 months in the Northwest and Western Central Atlantic (Springer 1960, Colvocoresses and Musick 1989), 12 months off Brazil (Hazin et al. 2006), 11?12 months off South Africa (Bass et al. 1973, Cliff et al. 1988) and the East China Sea (Taniuchi 1971), 10?12 months off Taiwan (Province of China) (Joung and Chen 1995) and 12 months off Western Australia (McAuley et al. 2007). Females apparently have young only every two or three years. Joung and Chen (1995) noted that about 50% of mature females are pregnant off Taiwan (Province of China), and Cliff et al. (1988) reported the same off KwaZulu-Natal. Conversely Springer (1960) noted that only 17?27% of mature females captured off Florida were pregnant. However, most of the mature females examined in the mid-Atlantic Bight of the US in summer are pregnant or recently have born young (Colvocoresses and Musick 1989). Therefore, the pregnancy rate in the Northwest Atlantic may be near 50%, but it is difficult to obtain a synoptic sample of the entire population of mature females because of their wide geographic distribution and seasonal movements. McAuley et al. (2007) report biennial reproductive periodicity off Western Australia with mating occurring during summer and autumn.

In general, size at maturity, maximum size and litter size decrease from the western Atlantic (Sminkey and Musick 1996) to the western Indian Ocean (Bass et al. 1973, Baranes and Wendling 1981), to Taiwan (Joung and Chen 1995) and Australia (Last and Stevens 1994), to the east China Sea (Taniuchi 1971) to Hawaii (Wass 1973). Size at maturity in females ranges from 129?158 cm total length (TL) and from 123?156 cm TL in males, as summarized by McAuley et al. (2007). Litter size is variable and depends in part on the size of the mother. In the Northwest and Western Central Atlantic litter size averages 8.4?9.3 (range = 1?14). However, in Hawaii mean litter size is only 5.5 (range = 1?8) (Tester 1969). In Western Australia litter size varies from 4?10 with a mean of 6.5 (McAuley et al. 2007). Within a given geographic area litter size is only very weakly correlated with the size of the mother (Cliff et al. 1988, Colvocoresses and Musick 1989, Hoff 1990, Joung and Chen 1995, McAuley et al. 2005).

Size at birth varies slightly by region but does not follow the same geographic pattern. New born pups range from 40?53 cm TL. In the Gulf of Gabes, Mediterranean Sea, Capapé (1984) reported size at birth at 58?65 cm TL. Size at birth in Western Australia is 40?45 cm FL. And 60% of the embryos were female (McAuley et al. 2007).

Sandbar Sharks are slow-growing K-selected species (Hoff 1990, Sminkey and Musick 1995). Although growth and age at maturity may be accelerated under captive conditions (Wass 1973), wild populations grow very slowly and mature at a relatively late age. In the western Atlantic the von Bertalanffy growth coefficient, k, has been estimated to be very low (0.039?0.089) in validated studies using annuli on vertebral centra (Lawler 1976, Casey et al. 1985, Sminkey and Musick 1995). Maturity in these studies was estimated at 13?16 years. However, in another study based on growth rates calculated from tag/recapture data, growth was considerably slower and age at maturity was estimated to be 29 years (Casey and Natanson 1992). Considerable debate has arisen concerning the discrepancy between the two methods including the small tag/recapture sample size and the possible effects of tagging on growth rates (Sminkey 1994). A recent study of age and growth off Taiwan (Joung et al. 2004) based on caudal vertebrae for which the annual nature of growth bands have not been validated is suspect. Romine et al. (2006) recently defined age and growth of sandbar sharks in Hawaii where the population grow faster (k male = 0.12; k female = 0.10) and mature at an earlier age (males at 8 and females at 10 years of age, respectively) than populations in other areas. This study contradicts earlier very rapid growth estimates in captive sandbars (Wass 1973). In Western Australia, the annual periodicity of growth band formation was validated using vertebrae from tagged sharks, which were injected with oxytetracycline and were at liberty for up to 8.1 years. The oldest female was estimated to be 25 years of age and the oldest male was 19 years. The ages at which 50% of female and male sharks were mature was estimated to be 16.2 and 13.8 years, respectively (McAuley et al. 2006). Validated age at maturity estimates are available from McAuley et al. (2006): females reach 50% maturity at 16.2 years of age and males at 13.8 years of age.

Recent publications suggest that for sandbar sharks the annual population increase rate can vary from 2.5% to 11.9% (Sminkey 1994, Sminkey and Musick 1996). These low rates of intrinsic increase are probably close to the real situation and reflect the K-selected life history parameters typical of virtually all large sharks. In Western Australia the stock was estimated to have a potential rate of population growth of 2.5% per year, in the absence of fishing (McAuley et al. 2005). The estimated generation and population doubling times of approximately 23 years, indicated a lengthy recovery period for the stock should it be reduced to lower than acceptable levels (McAuley et al. 2005). Regardless, Sandbar Sharks grow slowly and mature late. Longevity is 35-41 years (Musick 2005, McAuley et al. 2006).

Diet: This shark mainly feeds on small bottom fishes, as well as molluscs and crustaceans. Compagno (2001) reports that this species? diet includes sardines, shad, menhaden, anchovies, sea catfishes, moray and snake eels, pipefish, barracuda, mullets, goatfishes, hairtails, spanish mackeral, bonito, mackeral, jacks, groupers, croakers, grunts, porgies, flounders and soles, sea robins, toadfish, cusk eels, porcupine fish, sharpnose sharks (Rhizoprionodon), spiny dogfish (Squalus), bonnethead sharks, guitarfish, skates, stingrays, cow-nosed rays, squid, cuttlefish, octopi, bivalves and conchs, amphipods, shrimp and crabs. Neonates may consume mostly crabs and other large crustaceans and then eat more fishes as they get older (Ellis and Musick 2007). The species does not consume garbage and mammalian carrion as a rule, unlike some other members of its genus.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Sandbar sharks tend to be coastal, typically found on muddy or sandy flats in bays, harbors, estuaries and river mouths. They may also be found offshore, on banks near islands or flat reefs. Sandbar sharks may live in depths ranging from 1 m (inter tidal waters) to 280 m in water with salinities of ~20 parts per thousand (ppt). Juveniles inhabit coastal nursery areas of temperate waters to eat and avoid predation. Adults are migratory and prefer tropical waters.

Range depth: 1 to 280 m.

Average depth: 20-55 m.

Habitat Regions: temperate ; tropical ; saltwater or marine

Aquatic Biomes: pelagic ; coastal

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 514 specimens in 1 taxon.
Water temperature and chemistry ranges based on 286 samples.

Environmental ranges
  Depth range (m): 6 - 2755
  Temperature range (°C): 2.768 - 26.900
  Nitrate (umol/L): 0.164 - 31.978
  Salinity (PPS): 32.865 - 36.580
  Oxygen (ml/l): 2.157 - 6.300
  Phosphate (umol/l): 0.083 - 1.950
  Silicate (umol/l): 0.777 - 29.441

Graphical representation

Depth range (m): 6 - 2755

Temperature range (°C): 2.768 - 26.900

Nitrate (umol/L): 0.164 - 31.978

Salinity (PPS): 32.865 - 36.580

Oxygen (ml/l): 2.157 - 6.300

Phosphate (umol/l): 0.083 - 1.950

Silicate (umol/l): 0.777 - 29.441
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 1800m.
Recorded at 1800 meters.

Habitat: pelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Brackish

Inshore/Offshore: Offshore, In & Offshore, Inshore

Water Column Position: Mid Water, Near Bottom, Bottom, Bottom + water column

Habitat: Reef (rock &/or coral), Corals, Reef and soft bottom, Reef associated (reef + edges-water column & soft bottom), Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Estuary, Water column

FishBase Habitat: Bentho-Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The sandbar shark inhabits coastal waters, favouring water that is 20 to 65 metres deep (3), but occasionally venturing as down to depths of up to 1,800 metres (6). Only occasionally can its large dorsal fin be seen protruding from the water's surface, as the sandbar shark prefers remaining near the bottom (2). It commonly occurs in harbours, lagoons, muddy and sandy bays, and river mouths, but never moves into freshwater. It tends to avoid sandy beaches, the surf zone, coral reefs and other rough-bottom habitats (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs on the continental shelf (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Sandbar sharks mainly feed opportunistically on small bottom fish, mollusks, and crustaceans. Research suggests that their diet is related to their size. Juveniles and smaller sharks mainly feed on crustaceans, such as blue crabs (Callinectes sapidus) and mantis shrimp (Lysiosquilla scabricauda). Larger sharks feed may feed on crustaceans as well, but will also consume elasmobranch prey including small sharks, skates, and rays. According to the IUCN Red List, a sandbar shark’s diet may include “sardines, shad, menhaden, anchovies, sea catfishes, moray and snake eels, pipefish, barracuda, mullets, goatfishes, hairtails, spanish mackeral, bonito, mackeral (Scomberomorus maculatus), jacks, groupers, croakers, grunts, porgies, flounders and soles, sea robins, toadfish, cusk eels, porcupine fish, sharpnose sharks (Rhizoprionodon terraenovae), spiny dogfish (Squalus acanthias), bonnethead sharks (Sphyrna tiburo), guitarfish, skates, stingrays, squid, cuttlefish, octopi, bivalves and conchs, amphipods, shrimp and crabs.” Sandbar sharks are known to feed more actively at night.

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods, Molluscivore )

  • Ellis, J., J. Musick. 2007. Ontogenetic Changes in the Diet of the Sandbar Shark, Carcharhinus plumbeus , in Lower Chesapeake Bay and Virginia (USA) Coastal Waters. Environmental Biology of Fishes, 80: 51-67.
  • Stillwell, C., N. Kohler. 1993. Food Habits of the Sandbar Shark Carcharhinus plumbeus off the U.S. Northeast Coast, with Estimates of Daily Ration. Fishery Bulletin, 91: 138-150.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), mobile benthic gastropods/bivalves, octopus/squid/cuttlefish, bony fishes, sharks/rays
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

According to Stillwell et al. (1993), sharks are an integral part of the flow of energy in marine ecosystems. Sandbar sharks are considered predators rather than prey, but juveniles may be preyed upon by other sharks. Sandbar sharks are a common host for a number of parasitic copepods, including those in the families Pandaridae, Caligidae, Euphoridae, and Eudactylinidae. Other parasites are isopods in the Gnathiidae family and annelids in the Hirudinidae family, which are both typically attached to the gill filaments. Copepods are often found on the body or fins of the sharks.

Commensal/Parasitic Species:

  • Newbound, D., B. Knott. 1999. Parasitic Copepods from Pelagic Sharks in Western Australia. Bulletin of Marine Science, 65: 715-724.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Like many other types of sharks, sandbar sharks have few predators. Pups and juveniles, however, often become prey of larger members of the Chondrichthyes class. The only other predators to sandbar sharks are humans (Homo sapiens). They are very popular in shark fisheries and are the most common shark fished on the east coast of the United States. According to the IUCN Red List “sandbar sharks were found to represent at least 2 to 3% of the fins auctioned in Hong Kong, the world’s largest shark fin trading center.” Due to the high value of their fins they are overfished and therefore have experienced population declines.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

There is little information on communication between sandbar sharks. Although, during mating, male sandbar sharks will bite the females until they flip upside down. Sharks have excellent sensory acuity that aid in finding prey and avoiding predators. They have an exquisite sense of smell that is useful for locating food. Sharks also have an electrosensory system, which is an ampullary electroreceptor system. With this system, sharks are capable of detecting “weak extrinsic electric stimuli as low as 5 nV/cm,” according to Carrier et al. (2004)

Communication Channels: tactile

Perception Channels: visual ; acoustic ; chemical ; electric ; magnetic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Viviparous (Ref. 26281), placental (Ref. 50449), 1-14 pups in a litter; 56-75 cm at birth (Ref. 2334); gestation period of 12 months (Ref.58048). Distinct pairing with embrace (Ref. 205). Sexual dimorphism is evident in the thicker skin layer of maturing and adult females (Ref. 49562). This thickened skin may serve as protection from the 'bites' the female species receive from the males during precopulation and in the rugged conditions of the rock and coral environment where they live (Ref. 49562). Pups are born from Feb. to April in Northeastern Taiwan (Ref. 37027).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

Sandbar sharks have internal fertilization and are viviparous, meaning they give birth to live young. The embryos remain in the uterus for 9 to 12 months until they are fully developed, during which time they receive nutrients from the placenta. When the pups are born they have the same physical features as adults, but they are smaller. It takes about 8 years for sandbar sharks to mature.

  • Carrier, J., J. Musick, M. Heithaus. 2004. Biology of Sharks and their Relatives. Boca Raton, FL: CRC Press LLC.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Sandbar sharks are considered long-lived. However, few sources reveal information on the lifespan and longevity of sandbar sharks. In one study, Joung et al. (2004) found the oldest male to be 19.8 years old and the oldest female to be 20.8 years old. While, Sminkey et al. (1996) mention that sandbar sharks can live to be over 30 years old. According to Joung et al. (2004), “lack of accurate age information on sharks has been a major stumbling block to fisheries research.” Sandbar sharks can be found in captivity in aquariums, but captive lifespan is unknown.

Average lifespan

Status: wild:
20 years.

  • Sminkey, T., J. Musick. 1996. Demographic Analysis of the Sandbar Shark, Carcharhinus plumbeus, in the Western North Atlantic. Fishery Bulletin, 94: 341-347.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 32 years Observations: These animals live at least 30 years (Das 1994), but it is possible that some may live over 50 years (http://www.fishbase.org/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Male and female sandbar sharks only interact during mating; otherwise the sexes swim in separate schools. To initiate mating, male sandbar sharks follow and bite the dorsal fins of females until they flip over. Once flipped over, the male inserts one clasper into the cloaca. Sandbar sharks are considered polygynandrous, meaning females will reproduce with multiple males.

Mating System: polygynandrous (promiscuous)

Sandbar sharks mate in the warm months of the year and females only give birth every 2 to 3 years. The gestation period for sandbar sharks ranges between 9 and 12 months and they may give birth to litters ranging from 1 to 14 pups. The gestation period, litter size, and time of the year when pups are born vary depending on geographic location. Males reach sexual maturity at 160 to 165 cm total length or when claspers are fully developed and have reached the proper hardness. Female sharks reach sexual maturity at 165 to 170 cm total length. Sex differentiation research has shown that levels of steroid hormones may be responsible for development of gonads and secondary sex organs. When near birth, females will enter nursery grounds. At birth, pups range in length from 56 to 75 cm, but some sources have found pups as small as 40 cm. Pup size may be related to mother size, environment, and litter size. Sandbar sharks are the slowest growing and latest maturing of all sharks.

Breeding interval: Sandbar sharks breed every 2 to 3 years, usually in the warmer months.

Breeding season: Mating occurs in warm months; months vary due to geographic location.

Range number of offspring: 1 to 14.

Average number of offspring: 5-12.

Range gestation period: 9 to 12 months.

Average time to independence: 0 minutes.

Average age at sexual or reproductive maturity (female): 7.5 - 8.2 years.

Average age at sexual or reproductive maturity (male): 8.2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

There is little information regarding any parental investment of sandbar sharks after birth. However, females invest heavily in protecting the young during their development before birth.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female)

  • 2009. "International Union for Conservation of Nature and Natural Resources" (On-line). The IUCN Red List of Threatened Species - Carcharhinus Plumbeus. Accessed February 03, 2010 at http://www.iucnredlist.org/apps/redlist/details/3853/0.
  • Compagno, L., M. Dando, S. Fowler. 2005. Sharks of the World. Princeton: Princeton University Press.
  • Joung, S., C. Chen. 1995. Reproduction in the Sandbar Shark, Carcharhinus plumbeus, in the Waters off Northeastern Taiwan. Copeia, 3: 659-665.
  • Joung, S., Y. Liao, C. Chen. 2004. Age and Growth of Sandbar Shark, Carcharhinus plumbeus, in Northeastern Taiwan Waters. Fisheries Research, 70/1: 83-96.
  • Portnoy, D., A. Piercy, J. Musick, G. Burgess, J. Graves. 2007. Genetic polyandry and sexual conflict in the sandbar Shark, Carcharhinus plumbeus, in the western North Atlantic and Gulf of Mexico. Molecular Ecology, 16: 187-197.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Egg Type: Live birth, No pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carcharhinus plumbeus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 18 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTGATTTTTGGTGCATGAGCAGGTATAGTTGGAACAGCCCTAAGTCTCCTAATTCGAGCTGAACTTGGGCAACCTGGATCACTTTTAGGGGATGATCAGATTTATAATGTAATTGTAACCGCCCACGCTTTTGTAATAATCTTTTTTATAGTTATACCAATTATAATTGGTGGTTTCGGAAATTGATTAGTTCCTTTAATAATTGGTGCACCAGATATAGCCTTCCCACGAATAAATAACATAAGTTTCTGACTTCTTCCACCATCATTTCTTCTTCTCCTCGCCTCTGCTGGAGTAGAAGCTGGAGCAGGTACTGGTTGAACAGTCTATCCCCCATTAGCTAGTAACCTAGCACATGCTGGACCATCTGTTGACTTAGCTATTTTCTCTCTTCACTTAGCCGGTATTTCATCAATTTTAGCTTCAATTAATTTTATTACAACAATTATTAACATAAAACCACCAGCCATTTCACAATATCAAACACCATTATTTGTTTGATCTATTCTTGTAACCACTATTCTTCTTCTCCTCTCACTTCCAGTTCTTGCAGCAGGGATTACAATACTACTTACAGATCGTAACCTCAACACTACATTCTTTGACCCTGCGGGTGGAGGAGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Carcharhinus plumbeus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Specimens with Barcodes: 101
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LR/cd
Lower Risk/conservation dependent

Red List Criteria

Version
2.3

Year Assessed
2000

Assessor/s
Musick, J.A.

Reviewer/s
Musick, J.A. & Fowler, S. (Shark Red List Authority)

Justification
A large, slow-growing, late-maturing and low-fecundity coastal species, which is common and widespread in subtropical and warm temperate waters world-wide. It is an important component of shark fisheries in most areas where it occurs, although catch data are sparse. Severely overfished in the western North Atlantic, although the stock still contains over 100,000 individuals and supports an active and now tightly managed fishery. A management plan in US waters implemented in 1993 has led to stock stabilisation and the beginning of a recovery.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2bd+4bd

Version
3.1

Year Assessed
2009

Assessor/s
Musick, J.A., Stevens, J.D., Baum, J.K., Bradai, M., Clò, S., Fergusson, I., Grubbs, R.D., Soldo, A., Vacchi, M. & Vooren, C.M.

Reviewer/s
Dudley, S.D., Pollard, D., Kyne, P.M., Cavanagh, R.D., Valenti, S.V., Soldo, A. (Shark Red List Authority)

Contributor/s

Justification
This large coastal species is widespread in subtropical and warm temperate waters around the world. Tagging, age and growth studies show that Sandbar Sharks are long-lived, with low fecundity and are consequently very vulnerable to over-fishing. This species is an important component of shark fisheries in most areas where it occurs and has been overfished in the northwest and western central Atlantic and Mediterranean Sea. Population declines are suspected to have occurred off southern Brazil and in the northeast Pacific. Off Australia, biomass has also decreased to ~35% of pre-fishery levels as a result of fishing off Western Australia, although management is in place to prevent further declines there. In Hawaiian waters, the species is common and not fished. Given the high intrinsic vulnerability of this species? to depletion, significant declines estimated and suspected in several areas of its range and inferred declines in highly fished areas from which data are not available, C. plumbeus is assessed as Vulnerable globally.

Mediterranean
Both coastal and pelagic waters of the Mediterranean Sea have been intensively exploited for many decades. Catches of this species have declined significantly along the Levantine coasts. Sandbar Sharks were previously regularly seen on fish markets of southern Sicily but have not been observed on the same markets in recent years. While the Gulf of Gabès, Tunisia, and an area off Turkey appear to be important nursery grounds for this species, recent records of the species in the Mediterranean outside these areas appear to be rare and there are no recent records of gravid females outside these areas. Given that this region is subject to high levels of continuing fishing pressure, the high biological vulnerability of this species, evidence for declines in the Mediterranean and declines inferred from other areas where it is heavily fished, C. plumbeus is assessed as Endangered in the Mediterranean Sea, which unlike the US and Australian stocks is not subject to management.

Southwest Atlantic
This species is taken as both a target and bycatch of coastal and pelagic fisheries in this region. Off southern Brazil, intensive fishing by pair trawl, gillnet and beach seine on pupping and nursery grounds is thought to have caused excessively high juvenile mortality. Fishing with these gears has been intense in this species? habitat during the last 20 years. Records of typical beach seine catches in the early 1980s indicate that 20 individuals could be taken in a single haul. Conversely, no catches of the species were observed during shore fishery monitoring in summer 2003, but neonates of C. plumbeus were common during monitoring of a coastal fishing at depths of 18?60 m between Tramandaí and Saint Simão in summer 2005. Adults of this species are also caught by domestic and international pelagic fisheries operating off the Atlantic coast of South America. This species is taken, along with other Carcharhinids in these fisheries. Tuna and swordfish longline fisheries now also target sharks due to increasing demand for shark products and the value of their fins.

Northwest Atlantic
Sandbar Shark is taken in recreational and commercial fisheries along the south Atlantic coast of the USA and in the Gulf of Mexico, which have expanded rapidly during the last >20 years. Sandbar shark stocks were reduced by 85?90% in just 10 years because of over-exploitation and only continued to support a fishery because of the very large size of the original stock. Adult females became very uncommon and the average size of individuals has declined by ~70% of the average size in 1975. Although management was introduced in 1993 and the biomass of the species was reported to have increased by 2002, a recent assessment estimated that the stock is still only 35?47% of virgin biomass and 26?43% of virgin mature abundance in numbers. Newly available analyses of survey data also estimate significant declines (of between 84% and 97% over time periods of 13?41 years). Sandbar Shark is listed as a prohibited species on the US Fishery Management plan for Atlantic sharks. All this considered, the Night Shark is assessed as Vulnerable globally based on significant population declines throughout its northwest and western central Atlantic range due to target and bycatch exploitation by fisheries, which although now managed in US waters, is not the case elsewhere in the region.

Australia
Sandbar Sharks are an important component of the Western Australian shark fishery. Current total biomass is probably at about 35% of its level prior to the start of full-time northern shark fishing. Current management arrangements in the fishery should arrest any further declines in stock biomass, but continued monitoring and assessment will be essential to monitor the stock, and the effectiveness of these measures. All this considered, the species is assessed as Near Threatened throughout Australian waters, close to meeting the criteria for Vulnerable A1bd. Continued monitoring and regular reassessment is recommended.

Hawaii
The species is common and not fished in Hawaiian waters, where the population is presumed stable and therefore assessed as Least Concern.

Northwest Pacific
This species is a known catch of longline, trawl and set net fisheries, likely operating throughout large areas of its range in this region. Japanese catch data on sandbar sharks are limited, but reported landings in Japan?s coastal ports show a sharp decline since 1992, from 126 mt per annum at that time, to 91 mt in 1995, 21 mt in 2000 and 3 mt in 2004. No CPUE data are available, however catches and the average size of individuals off Taiwan, Province of China, have also declined. Given this, the species? limiting life-history characteristics, the declining trends estimated elsewhere and continuing, unregulated fishing pressure in this region, an assessment of at least Near Threatened is considered appropriate. Further research on the species? status in this region is required due to concern that it may meet the criteria for Vulnerable A2d.

History
  • 2000
    Lower Risk/near threatened
  • 1996
    Vulnerable
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Slow growth rate and late maturation make sandbar sharks extremely vulnerable to overfishing. This is a concern due to their wide popularity in coastal fisheries worldwide. In 1996, the International Union for Conservation of Nature and Natural Resources (IUCN) Red List assessed them as vulnerable, but were re-assessed and changed to Lower risk/near threatened in 2000. Then, in 2007 sandbar sharks were listed again as vulnerable.  In 1993, a management plan was created for the U.S. that involves catch and size restrictions for commercial fisheries. The plan seems to have helped slow the decline in the North Atlantic population. Western Australia has also implemented a management plan with similar guidelines. Management plans for other parts of the world have been slow coming due to insufficient data on age and growth of the sharks.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Listed, Near threatened

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Lower Risk / Near Threatened (LR/nt) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Vulnerable (VU) (A2bd+4bd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Severely overfished in the western North Atlantic. It is caught with longlines, hook-and-line, and set bottom nets and is also fished with rod and reel by sports anglers as a game fish. It is utilized fresh, fresh-frozen, smoked and dried salted for human consumption; the hides are prized for leather and other products; the fins are prepared as the base for shark-fin soup; and the liver is extracted for oil (rich in vitamins) (Compagno 1984).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Carcharhinus plumbeus is a significant component of coastal shark fisheries worldwide (Bass et al. 1973, Compagno 1984b, Last and Stevens 1994, Branstetter and Burgess 1995, Joung and Chen 1995, McAuley et al. 2005). This species is caught with longlines, hook-and-line, and set bottom nets and is also fished with rod and reel by sports anglers as a game fish (Compagno in prep.). Sandbar sharks were found to represent at least 2-3% of the fins auctioned in Hong Kong, the world?s largest shark fin trading center (Clarke et al. 2006a). Their fins are generally considered to be of high value, comparable to dusky shark and hammerhead fins (S. Clarke unpubl. Data). Tagging, age and growth studies show that sandbar sharks are a long-lived species with low fecundity and are very vulnerable to over-fishing (Springer 1960, Casey et al. 1985, Sminkey and Musick 1995, 1996; McAuley et al. 2005, 2006). It is an important component of shark fisheries in most areas where it occurs and has been severely overfished in the Northwest and Western Central Atlantic, Mediterranean, Southern Brazil and probably the Northeast Pacific. It has declined from fishing off western Australia and is common but not fished in Hawaiian waters (Romine et al. 2006).

Northwest Atlantic
Along the Atlantic coast of the US, Branstetter and Burgess (1995) reported that this species contributed up to 60% of the catch and 80% of the landings in the directed longline fishery. In addition, the sandbar shark is second only to the blue shark Prionace glauca (a pelagic species) in the US Atlantic recreational shark fishery (Hoff and Musick 1990). During the last 20 years the recreational and commercial fisheries for sharks along the south Atlantic coast of the US and in the Gulf of Mexico have expanded at rapid rates (Anderson 1985, 1990; Casey and Hoey 1985, Hoff and Musick 1990). Recreational catch has been estimated at 2.5 million sharks (c.35,000 t) annually; 20?40% of these are killed (National Marine Fisheries Service 1993). Driven by increased marketability, the commercial fishery has rapidly expanded since 1985, with landings exceeding 7,100 t in 1989 (National Marine Fisheries Service 1993). In the Northwest and Western Central Atlantic sandbar shark stocks were reduced by 85?90% in just 10 years because of over-exploitation. This species continued to support a substantial fishery after such a severe population decline only because of the very large size of the original stock. In addition, the age structure of the population has been shifted dramatically toward younger age classes. Adult females became very uncommon (Musick et al. 1993). Furthermore, the average size of sandbar sharks off Virginia in 2005 had declined to 32% of the size in 1975 (Ha 2006). A Fishery Management Plan was introduced in 1993, on which C. plumbeus is managed as a coastal species. Several states (Virginia, North Carolina, Texas and Florida) also enacted laws to regulate shark fishing in their respective regions (14% of commercial and 64% of recreational catches occur in state controlled waters). Although biomass of the species was reported to have increased by 2002 (Cortes et al. 2002), a recent assessment estimated that the stock is still only 35-47% of virgin biomass and 26-43% of virgin mature abundance in numbers (SEDAR 2006). Further evidence of decline comes from newly available analyses of survey data: A shark-targeted longline research survey from the University of North Carolina, conducted annually between 1972 and 2003 off Cape Lookout has caught 310 sandbar sharks. The standardized CPUE time series for this survey indicates significant declines for sandbar shark amounting to an 86% decline, with no recovery in the latter years of the survey (Myers et al. in prep). A second shark-targeted longline survey conducted in South Carolina in 1983-84 and 1993-1995 shows large significant declines in sandbars, amounting to a 97% decline just over this 13 year time period (Myers et al. in prep). Finally, a trawl survey conducted in Delaware Bay by the Delaware Department of Natural Resources and Environmental Control between 1964 and 2004 shows a significant decline rate, that over this 41 year time period amounts to an 84% decline (Myers et al. in prep).

Southwest Atlantic
Intensive fishing by pair trawl, gillnet and beach seine on pupping and nursery grounds is thought to have caused excessively high juvenile mortality to the point of threatening the population of the species in southern Brazil. Fishing with these gears has been intense in this species? habitat during the last 20 years. The company SOPESCA in Rio Grande recorded receipt of 10t of C. plumbeus on 11 February 1983. A record of a typical beach seine catch on 23 February 1983 indicates that 20 individuals of C. plumbeus were caught within a single haul, with seven specimens smaller than 80cm TL (Vooren et al. 2005). No catches of the species were observed during shore fishery monitoring in summer 2003, but neonates of C. plumbeus were common during monitoring of a coastal fishing at depths of 18-60m between Tramandaí and Saint Simão in summer 2005. Neonates of C. brevipinna, C. falciformis and C. signatus were also observed in this area, as well as adults of Carcharias taurus, which is Critically Endangered in this region (Vooren et al. 2005). Carcharhinus plumbeus is also caught off Uruguay and northern Argentina (A. Domingo pers. comm.).

Adults of this species are also caught by pelagic fisheries operating off the Atlantic coast of South America. A number of countries operate longline fleets targeting tuna and swordfish in the high seas areas of the Southwest Atlantic region. In addition to the coastal nations of the Southwest Atlantic, nations including Taiwan, Korea, Japan, Spain, Bolivia, Cape Verde, United Kingdom, China and Barbados also operate vessels here. However, with the exception of Taiwan, (and during certain periods of the year, Korea and Spain), the effort of these fleets is minor compared with other areas of the Atlantic (Bonfil 1994). This species is taken, along with other Carcharhinids in these fisheries (Fowler et al. 2005). Tuna and swordfish longline fisheries now also target sharks due to increasing demand for shark products and the value of their fins (Bonfil et al. 2005, Mejuto et al. 2006).

Mediterranean Sea
Carcharhinus plumbeus is caught with surface and bottom longlines, gillnets and occasionally trawls in the Mediterranean Sea, including in the Sicilian Channel, off Tunisia, Libya and Egypt, Spain, Morocco and Algeria and infrequently elsewhere. There are also anecdotal reports of bycatch of this species in fixed tuna traps (Tonnara) in Sicily. Both coastal and pelagic fishing pressure is high throughout much of the Mediterranean Sea.

This species was common until the 1980s along all the Levantine coasts (Saad et al. 2004), where it was the most dominant species in shark catches (>85%) (Baranes and Ben Tuvia 1978). The sandbar shark C. plumbeus is still the most important shark species captured in this area, however, there has been a significant decline in captures (M. Bradai pers. obs. 2008).

The Gulf of Gabès, Tunisia, and an area off Turkey appear to be important nursery grounds for this species (Capapé 1984, Saidi et al. 2005; Bradai et al. 2006, STECF 2003). There are no recent records of gravid females of this species in the Mediterranean outside of these areas. Constantini and Affronte (2003) report that the northern Adriatic Sea may also be an important nursery area for the species, based on six neonatal sandbar sharks captured with gillnets in this area between 1998 and 2000. The last record of a pregnant female sandbar shark from this area was recorded in 1982 (Constantini and Affronte 2003, Travaglini 1982).

This species was previously regularly seen on fish markets of southern Sicily during the summer months but has not been observed on the same markets in recent years (F. Cigala-Fulgosi and M. Vacchi pers. obs. 2003). A similar situation is apparent in the eastern Adriatic sea (Lipej et al. 2000, A. Soldo pers comm.) and therefore recent publications have described C. plumbeus as an endangered species in the Adriatic Sea (Lipej et al. 2004). However, in Tunisia, the species is regularly landed and observed in fish markets (Bradai et al. 2006).

In the Gulf of Gabès, juvenile C. plumbeus are caught with longlines and trawls and adult females are targeted using specially-designed gillnets (locally known as ?kallabia? from ?kalb? bhar? (literally sea dog) which means shark in Arabic) during spring and early summer, when they move inshore to pup (Saidi et al. 2005, Bradai et al. 2006). Given the high biological vulnerability of this species to exploitation, the declines observed in other areas of its range where it is taken as a target and bycatch and continuing, unregulated fishing pressure in this area, it is strongly suspected that this stock will also decline.

The species is a known bycatch of pelagic fisheries operating within Mediterranean waters (STECF 2003), but recent records appear to be very rare. While, in the Gulf of Gabès, juvenile C. plumbeus represent a major component in total capture of the pelagic fisheries targeting swordfish (Bradai et al. 2006). In a study of incidental catch of pelagic sharks from the swordfish and tuna fisheries operating throughout the Mediterranean Sea from 1998-2000, only two specimens of C. plumbeus were recorded in one area (the Straits of Sicily) (Megalofonou et al. 2005). Although blue shark, shortfin mako and thresher sharks make up the bulk of shark catch in the Moroccan pelagic driftnet fisheries in the eastern Mediterranean, Carcharhinid species are also known to be taken and landed by this fleet on an occasional basis. Some boats are known to deploy their nets near to the coast (1-2 miles from the shore) to target pelagic sharks (Tudela et al. 2005). Important catches of Carcharhinids such as C. plumbeus are also made in the pelagic longline fishery operating from ports in eastern Algeria (Walker et al. 2005).

Habitat degradation of this species? coastal nursery areas through coastal development and pollution also poses an important threat.

Northwest and Western Central Pacific
This species is a known catch of longline, trawl and set net fisheries operating throughout large areas of this region. It is a known catch of shark longline and tuna gillnet fisheries operating off Indonesia (White et al. 2006). Japanese data on sandbar sharks are limited, but reported landings in Japan?s coastal ports show a sharp decline during the period since 1992. At that time landings totaled 126 mt per annum, but this amount decreased to 91 mt in 1995, 21 mt in 2000 and 3 mt in 2004. No CPUE trends are available (Japan Fisheries Agency 2006). In Taiwan, Province of China, catches and sizes have decreased during recent years, particularly in north east waters (Chen et al. 1996).

Australia
Sandbar sharks are an important component of the Western Australian shark fishery. Current total biomass is probably at about 35% of its level prior to the start of full-time northern shark fishing. Current management arrangements in the fishery should arrest any further declines in stock biomass, but continued monitoring and assessment will be essential to monitor the stock, and the effectiveness of these measures. See McAuley et al. (2005) for a summary of the fishery and stock status.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The slow growth, late sexual maturity and low reproductive output of the sandbar shark are all biological factors that make this shark vulnerable to overfishing. In most areas of its range, the sandbar shark is an important component of shark fisheries. The flesh is consumed by humans, the thick skins are prized for leather, vitamin-rich oil is extracted from the liver, and the fins are sold to Asian markets for use in shark fin soup (2). Although comprehensive catch data of this species is lacking, it is known to be severely overfished in the western North Atlantic (1), indicating that populations could be similarly impacted in other parts of its range. The inshore habitats which are important nursery grounds for the sandbar shark may also be impacted by the activities of humans which alter and degrade the natural environment (12).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
A management plan in US waters implemented in 1993 has led to stock stabilisation and the beginning of a recovery.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Actions

Conservation Actions
Precautionary adaptive collaborative management of target and bycatch fisheries is needed for this biologically vulnerable shark. It is also essential to improve data collection and develop stock assessments for this species. Family Carcharhinidae is listed as highly migratory under the 1995 UN Agreement on the Conservation and Management of Straddling Fish Stocks and Highly Migratory Fish Stocks (UNFSA). The Agreement specifically requires coastal and fishing States to cooperate and adopt measures to ensure the conservation of listed species. To date, there has been little progress (see United Nations Convention on the Law of the Sea for further details). Also of relevance is the FAO International Plan of Action for the Conservation and Management of Sharks (IPOA-Sharks) which recommends that Regional Fisheries Organisations (RFO?s) carry out regular shark population assessments and that member States cooperate on joint and regional shark management plans. This is of particular importance for species such as sandbar shark whose stocks are exploited by many States on the high seas. Steps are being taken by some RFOs, such as ICCAT, to collect species-specific data on pelagic sharks. To date two RFOs, ICCAT and IATTC, have adopted finning bans, as have several range states (e.g. Canada, USA, EU, Australia, Brazil etc.). More are likely to follow suit.

Canada and the USA have shark management plans (NMFS 1993, Joyce 1999). In US Atlantic waters Sandbar Sharks are a prohibited species (outside of the shark research fishery) on the Fishery Management Plan for Atlantic tunas, swordfish, and sharks. Prohibited species must be released immediately with minimum injury and without removing them from the water.

The species is under a comprehensive management plan in Western Australia (McAuley et al. 2005). Management of the Australian fishery is through input controls implemented as time-gear units. In 2006, the Western Australian Government introduced a number of changes in all commercial fisheries to reduce mortality, particularly dusky and sandbar shark, including: a maximum size limit for dusky shark; additional controls on the use of longline; and the conversion of monthly gear units to daily gear units (McLoughlin 2008, McAuley et al. 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

A management plan for the sandbar shark, involving catch quotas and size restrictions, was implemented in U.S. waters in 1993. Subsequently, the depleted western North Atlantic population has ceased declining and is beginning to show signs of recovery (1). Further reductions and size restrictions have been proposed to enhance the chances for population recovery; as even if the fishery was completely banned, the sandbar shark would still take several decades to recover (12). The lack of data on populations and catches from other regions is worrying, as the sandbar shark could be edging towards a more threatened status without us even knowing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Sandbar sharks are not considered a threat to humans, although their size could make them dangerous. They may become aggressive when provoked.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Sandbar sharks are a large part of the commercial shark fishery in the eastern United States as well as numerous other parts of the world. They are caught for their hide, meat, fins, and liver. Sandbar sharks, above other types are sharks, are more sought after because of their size and high fin-to-carcass ratio. In recent decades, demand for them has increased tremendously. Sandbar sharks make up about 60% of the catch in fisheries along the United States Atlantic coast. Recreational fishermen also catch them as a game fish.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Sandbar shark

The sandbar shark, Carcharhinus plumbeus, is a species of requiem shark, family Carcharhinidae, native to the Atlantic Ocean and the Indo-Pacific. It is distinguishable by its very high first dorsal fin and inter-dorsal ridge.[2]

Illustration of a sandbar shark.

The sandbar shark is also called the thickskin shark or brown shark. It is one of the biggest coastal sharks in the world, and is closely related to the dusky shark, the bignose shark, and the bull shark. Its dorsal fin is triangular and very high and it has very long pectoral fins. Sandbar sharks usually have heavy-set bodies and rounded snouts that are shorter than the average shark's snout. Their upper teeth have broadly uneven cusps with sharp edges. Its second dorsal fin and anal fin are close to the same height. Females reach sexual maturity around the age of 13 with an average fork-length (tip of the nose to fork in the tail) of 154.9 cm, while males tend to reach maturity around age 12 with an average fork-length of 151.6 cm.[3] Females can grow to 2/2.5 m, males up to 1.8 m. Its body color can vary from a bluish to a brownish grey to a bronze, with a white or pale underside. Sandbar sharks swim alone or gather in sex-segregated schools that vary in size.

The sandbar shark, true to its nickname, is commonly found over muddy or sandy bottoms in shallow coastal waters such as bays, estuaries, harbors, or the mouths of rivers, but it also swims in deeper waters (200 m or more) as well as intertidal zones. Sandbar sharks are found in tropical to temperate waters worldwide; in the western Atlantic they range from Massachusetts to Brazil. Juveniles are common to abundant in the lower Chesapeake Bay, and nursery grounds are found from Delaware Bay to South Carolina. Other nursery grounds include Boncuk Bay in Marmaris, Muğla/Turkey[4] and the Florida Keys[3]

Sandbar shark caught in the Atlantic.

Natural predators are the tiger sharks, and rarely great white sharks. The sandbar sharks prey on fish, rays, and crabs.

Sandbar sharks are viviparous. The embryos are supported in placental yolk sac inside the mother. Females have been found to exhibit both biennial and triennial reproductive cycles, ovulate in early summer, and give birth to an average of 8 pups, which they carry for 1 year before giving birth.[3] .

Sandbar sharks have been disproportionately targeted by the U.S. commercial shark fisheries in recent decades due to their high fin-to-body weight ratio, and U.S. fishing regulation requiring carcasses to be landed along with shark fins. In 2008, the National Marine Fisheries Service banned all commercial landings of Sandbar Sharks based on a 2006 stock assessment by SEDAR, and Sandbar Sharks were listed as vulnerable, due to overfishing. Currently, there are a small number of specially permitted vessels fishing for Sandbars Sharks for the purpose of scientific research. All vessels in the research fishery are required to carry an independent researcher while targeting Sandbars. [3]

See also

References

  1. ^ Shark Specialist Group (2000). Carcharhinus plumbeus. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on May 9, 2006.
  2. ^ Ferrari, A. and A. (2002). Sharks. New York: Firefly Books. ISBN 1-55209-629-7. 
  3. ^ a b c d Hale, Lorainne F.; Ivey E. Baremore (1). "Reproduction of the Sandbar Shark in the Western North Atlantic Ocean and Gulf of Mexico". Marine and Coastal Fisheries: Dynamics, Management, and Ecosystem Science (American Fisheries Society) 4: 560-572. 
  4. ^ [1]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!