Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Caught using shrimp traps (Ref. 40969).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is located off southwestern Taiwan but its actual distribution range is not known due to insufficient sampling.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Taiwan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northwest Pacific: Taiwan.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Max. size

76.8 cm TL (male/unsexed; (Ref. 40969))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Head white; body and tail grayish-black to dark purple. A 3-cusp multicusp on the anterior set of cusps and 2-cusp multicusp on the posterior set. Gill pouches, generally 5 pairs (rarely 4). Slime pores 0 - 4 (mostly 2) above the area between the anterior and posterior ends of the cloaca. Anterior unicusps 10 (8-12) on each side. Anterior part of ventral finfold (VFF) higher than posterior part (mostly vestigial). Caudal finfold (CFF) low to vestigial (Ref. 40969).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is located on slopes at depths from 588-1,500 m (Mok and Kuo 2001). The size range appears to be stratified by depth. According to Mok and Kuo (2001), 120 specimens ranging in length from 102-380 mm were collected in three different sites off southwestern Taiwan at depths of 588, 753, and 843 m, whereas 271 specimens ranging from 131-768 mm were also collected off southwestern Taiwan at deeper waters (1,000-1,500 m). This species is caught using shrimp traps (Mok and Kuo 2001).

The copulatory organ is absent for this species. The gonads of hagfishes are situated in the peritoneal cavity. The ovary is found in the anterior portion of the gonad, and the testis is found in the posterior part. The animal becomes female if the cranial part of the gonad develops or male if the caudal part undergoes differentiation. If none develops, then the animal becomes sterile. If both anterior and posterior parts develop, then the animal becomes a functional hermaphrodite. However, hermaphroditism being characterised as functional needs to be validated by more reproduction studies (Patzner 1998).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

bathydemersal; non-migratory; marine; depth range 588 - 1500 m (Ref. 40969)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 753 - 843
  Temperature range (°C): 5.614 - 5.614
  Nitrate (umol/L): 36.253 - 36.253
  Salinity (PPS): 34.440 - 34.440
  Oxygen (ml/l): 2.225 - 2.225
  Phosphate (umol/l): 2.513 - 2.513
  Silicate (umol/l): 94.785 - 94.785

Graphical representation

Depth range (m): 753 - 843
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Copulatory organ absent. The gonads of hagfishes are situated in the peritoneal cavity. The ovary is found in the anterior portion of the gonad, and the testis is found in the posterior part. The animal becomes female if the cranial part of the gonad develops or male if the caudal part undergoes differentiation. If none develops, then the animal becomes sterile. If both anterior and posterior parts develop, then the animal becomes a functional hermaphrodite. However, hermaphroditism being characterised as functional needs to be validated by more reproduction studies (Ref. 51361 ).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Myxine formosana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTCTACCTTATTTTCGGGGCATGAGCCGGAATAATTGGTACAGCTCTCAGTGTAATTATCCGAACAGAATTAAGCCAACCCGGATCTATAATTAATAATGATCAACTTTATAACACGATTATTACAGCCCACGCATTTGTTATAATCTTTTTTATAGTAATACCTGTCATAATTGGGGGTTTTGGAAACTGATTAGTCCCCATAATAATTGGAGCCCCAGATATAGCTTTTCCACGAATAAACAATATAAGTTTCTGACTTTTACCCCCATCACTTATACTTTTACTTTCTTCTTCATTAGTAAGTTCCGGCGCCGGGACTGGATGAACAGTTTACCCACCTCTTTCTAATCACATTTCCCATATAGGACCCTCAGTGGATCTGGCTATCTTCTCTCTACATTTAGCAGGAGTTTCCTCTATCTTAGCGGCGATCAACTTCATTACAACAATTACCAACATAAAAATACGATCTATGGAGATATATCATATCCCTTTATTTGTGTGATCAATTTTAATTACCGCAATTCTGCTCCTTTTATCTTTACCTGTTTTAGCCGCAGCTATCACTATACTTCTCACAGACCGTAACCTTAATACCACTTTTTTTGATCCTTCGGGGGGTGGAGACCCTATCCTGTATCAACATCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Myxine formosana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Mincarone, M.M. & Mok, H.-K.

Reviewer/s
Polidoro, B., Knapp, L. & Carpenter, K.E.

Contributor/s

Justification
This species is only known from a small area of southwestern Taiwan. It was once considered abundant, but has historically been targeted by local fisheries which have declined significantly to the point that the fishery ceased in the late 1990s. However, little or no baseline population data is available to calculate decline. It is listed as Data Deficient. More information is needed on this species distribution, population status, life history, biology, and the impact of current and historical threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The population information for this species is known from many specimens collected through surveys and from fish markets. Historically this species was previously large enough to support a small fishery (before 1997). The population has likely declined due to over-exploitation from fishery.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Before 1997, Myxine formosana was captured with plastic shrimp traps (365 cm length, 16 cm diameter) off southwestern Taiwan by the fishermen from Tong-Kung (Mok and Kuo, 2001). It was a small fishery but activity was intensive across the species' currently known distribution range. It is not known exactly how many vessels were operating within the fishery. It should be noted that since the late 1990's, the fishery has ceased, likely due to major decline in population abundance levels.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no conservation measures in place, but more research is needed on this species' biology, population size, distribution and impact of trap fishery operating across the species' distribution range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!