Overview

Comprehensive Description

Biology

Adults inhabit passages and outer reef slopes. Known to occur at 25°C. Feed chiefly on planktonic copepods, algae, echiuroid and sipunculoid worms, and pelagic tunicates. Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205). Associated with the anemones: Entacmaea quadricolor, Heteractis aurora, Heteractis crispa, Heteractis magnifica, Stichodactyla haddoni, and Stichodactyla mertensii (Ref. 5911).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Pacific Ocean: Queensland, Australia and New Guinea to the Marshall and Tuamoto islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10 - 11; Dorsal soft rays (total): 15 - 17; Analspines: 2; Analsoft rays: 13 - 14
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 170 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

17.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body short and deep; the head small. Generally yellow in the body edges, yellow-brown to dark brown in the middle sides, with two white vertical stripes, the first behind the eye and the second before the anus. The fins yellow. Juveniles are a dull orange (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 1 - 30 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 24 specimens in 1 taxon.
Water temperature and chemistry ranges based on 20 samples.

Environmental ranges
  Depth range (m): 1.83 - 35
  Temperature range (°C): 25.712 - 29.282
  Nitrate (umol/L): 0.051 - 0.279
  Salinity (PPS): 34.131 - 36.142
  Oxygen (ml/l): 4.444 - 4.764
  Phosphate (umol/l): 0.100 - 0.301
  Silicate (umol/l): 0.829 - 1.596

Graphical representation

Depth range (m): 1.83 - 35

Temperature range (°C): 25.712 - 29.282

Nitrate (umol/L): 0.051 - 0.279

Salinity (PPS): 34.131 - 36.142

Oxygen (ml/l): 4.444 - 4.764

Phosphate (umol/l): 0.100 - 0.301

Silicate (umol/l): 0.829 - 1.596
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 30m.
From 1 to 30 meters.

Habitat: reef-associated. Inhabits passages and outer reef slopes. Known to occur at 25°C. Commensal with the anemone @Heteractis crispa@, @Stichodactyla mertensii@, or @H. aurora@. Feeds chiefly on planktonic copepods, algae, echuroid and sipunculoid worms, and pelagic tunicates.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154). Commensal with a variety of host anemones; usually three to four fish per host, including an adult pair. Feeds on plants, benthic and planktonic invertebrates (Ref. 237).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205). Spawning pairs can be found throughout the year. The total annual egg production is estimated at 3,000 - 5,000 eggs (Ref. 237). Fecundity ranges from 128 - 632 (Ref. 237). Also Ref. 7471, 240.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Amphiprion chrysopterus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATCTAATTTTCGGTGCTTGAGCTGGGATAGTAGGCACGGCCTTAAGCCTTCTTATTCGAGCAGAATTAAGCCAACCAGGCGCACTTTTAGGAGATGATCAAATTTATAACGTTATTGTTACCGCACATGCCTTTGTAATGATTTTCTTTATAGTAATACCAATTCTAATTGGAGGATTTGGAAATTGACTAGTACCCCTAATGCTTGGCGCCCCCGATATAGCATTTCCTCGCATAAACAACATAAGCTTCTGGCTTCTCCCTCCCTCTTTCCTTCTTCTACTTGCCTCCTCAGGAGTTGAAGCCGGGGCCGGAACAGGCTGAACTGTGTACCCGCCACTGTCTGGAAACCTAGCCCATGCAGGGGCATCAGTAGACTTAACTATCTTCTCCCTCCACCTAGCAGGTGTCTCATCAATCCTTGGAGCAATCAACTTTATCACTACCATTATTAACATAAAACCCCCTGCTATCACACAGTATCAAACCCCTCTATTTGTTTGAGCTGTCCTAATTACTGCTGTTCTTCTTCTCCTTTCTCTCCCAGTTTTAGCTGCCGGTATTACTATGCTCTTAACGGACCGAAACCTAAATACTACCTTCTTTGACCCTGCAGGAGGAGGAGATCCAATTCTCTACCAACACCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Amphiprion chrysopterus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Orange-fin anemonefish

The orange-fin anemonefish or orange-fin clownfish, Amphiprion chrysopterus, is a clownfish, found in the Western Pacific north of the Great Barrier Reef from the surface to 20 m, to include the Pacific Ocean between Queensland, Australia and New Guinea to the Marshall and Tuamoto islands. It can grow to 17 cm in length.

It feeds on mainly on planktonic copepods, algae, echiuroid and sipunculoid worms, and pelagic tunicates.

Adults generally inhabit reef passages and slopes. Oviparous, distinct pairing during breeding. Eggs are demersal and adhere to the substrate. Males guard and aerate the eggs <[1]>. Associated with the anemones: Entacmaea quadricolor, Heteractis aurora, Heteractis crispa, Heteractis magnifica, Stichodactyla haddoni, and Stichodactyla mertensii <[2]>.

Dorsal spines (total): 10 - 11; Dorsal soft rays (total): 15-17; Anal spines: 2; Anal soft rays: 13 - 14. Body short and deep; the head small. Generally yellow in the body edges, yellow-brown to dark brown in the middle sides, with two white vertical stripes, the first behind the eye and the second before the anus. The fins yellow to orange. Juveniles are a dull orange. The tail fins are generally white or yellow and vary depending on the area of origin (fish in the area surrounding Fiji and Tonga have yellow tails, fish from the Marshall and Solomon Islands have white tails).<[3]>

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!