Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

A common species found in rocky and coral areas of subtidal coastal reefs (Ref. 9710). Enters shallow harbors and estuaries (Ref. 48636). Solitary or in small groups (Ref 90102).
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Indian Ocean: Maldives (Ref. 30829). Western Pacific.
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10; Dorsal soft rays (total): 12; Analspines: 3; Analsoft rays: 6
  • Myers, R.F. 1999 Micronesian reef fishes: a comprehensive guide to the coral reef fishes of Micronesia, 3rd revised and expanded edition. Coral Graphics, Barrigada, Guam. 330 p. (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 125 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

12.5 cm TL (male/unsexed; (Ref. 2334))
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Resemble C. oxycephalus but lacks spots on the tail and has a conspicuous opercular ocellus (Ref. 37816).Description: Characterized by white color with irregular red to brown bars and blotches; upper rear corner of gill cover with pale-edged dark brown spot; lower six pectoral rays unbranched; presence of palatine teeth; coarsely serrate posterior margin of preopercle; greatest depth of body 2.4-2.7 in SL (Ref 90102).
  • Myers, R.F. 1999 Micronesian reef fishes: a comprehensive guide to the coral reef fishes of Micronesia, 3rd revised and expanded edition. Coral Graphics, Barrigada, Guam. 330 p. (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Cirrhitichthys aprinus
Catalog Number: USNM 98901
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Year Collected: 1908
Locality: Vicinity of Jolo., Jolo Lt., S. 16 deg. E., 0.85 mile., Jolo Island, Philippines, Sulu Archipelago, Pacific
Depth (m): 42
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 5 - 40 m (Ref. 90102), usually 12 - 20 m (Ref. 27115)
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
  • Baensch, H.A. and H. Debelius 1997 Meerwasser atlas. Mergus Verlag GmbH, Postfach 86, 49302, Melle, Germany. 1216 p. 3rd edition. (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 50 specimens in 1 taxon.
Water temperature and chemistry ranges based on 26 samples.

Environmental ranges
  Depth range (m): 3.05 - 89.5
  Temperature range (°C): 23.278 - 27.250
  Nitrate (umol/L): 0.164 - 2.763
  Salinity (PPS): 34.925 - 35.493
  Oxygen (ml/l): 4.107 - 4.703
  Phosphate (umol/l): 0.147 - 0.316
  Silicate (umol/l): 0.380 - 5.767

Graphical representation

Depth range (m): 3.05 - 89.5

Temperature range (°C): 23.278 - 27.250

Nitrate (umol/L): 0.164 - 2.763

Salinity (PPS): 34.925 - 35.493

Oxygen (ml/l): 4.107 - 4.703

Phosphate (umol/l): 0.147 - 0.316

Silicate (umol/l): 0.380 - 5.767
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 40m.
Recorded at 40 meters.

Habitat: reef-associated. Collected at Aliwal - pers comm Elaine Heemstra E-mail 15 July 2002.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154). Feeds on benthic animals and fish (Ref. 275).
  • Hiatt, R.W. and D.W. Strasburg 1960 Ecological relationships of the fish fauna on coral reefs of the Marshall Islands. Ecol. Monogr. 30(1):65-127. (Ref. 275)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Pelagic spawner (Ref. 31569). Spawning ascents into the water column occurred over a distance of 0.3 to 0.6 m (Ref. 26305).
  • Sadovy, Y. and T.J. Donaldson 1995 Sexual pattern of Neocirrhites armatus (Cirrhitidae) with notes on other hawkfish species. Environ. Biol. Fish. 42(2):143-150. (Ref. 31569)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cirrhitichthys aprinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTGAGCTGGGATAGTCGGCACTGCCTTAAGCCTTCTCATTCGAGCTGAACTCAGCCAGCCAGGGGCCCTCCTGGGAGATGACCAAATTTATAATGTAATCGTTACAGCCCATGCATTTGTAATGATTTTTTTTATGGTTATACCAATTATAATTGGTGGCTTTGGAAACTGACTAATTCCCCTAATAATTGGAGCTCCTGATATAGCCTTCCCTCGAATAAATAATATAAGCTTCTGGCTTCTTCCCCCTTCCTTCTTACTTCTGCTAGCATCCTCTGGAGTTGAAGCAGGGGCAGGCACTGGATGAACAGTCTACCCCCCTCTAGCAGGCAACCTCGCCCATGCAGGAGCATCTGTAGATCTAACTATTTTCTCCCTTCATCTTGCAGGTATTTCTTCAATTTTAGGGGCTATTAATTTTATTACAACTATTATCAACATAAAACCCCCCTCTATTTCACAATATCAAACACCCCTATTTGTTTGAGCTGTCCTGATTACAGCAGTACTTCTTCTTCTATCCCTCCCAGTCCTTGCTGCCGGCATTACTATACTACTTACTGACCGGAATTTAAATACAACCTTCTTTGACCCTGCAGGGGGAGGAGACCCAATCCTTTATCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cirrhitichthys aprinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; aquarium: commercial
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 World fishes important to North Americans. Exclusive of species from the continental waters of the United States and Canada. Am. Fish. Soc. Spec. Publ. (21):243 p. (Ref. 4537)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Spotted hawkfish

The spotted hawkfish, Cirrhitichthys aprinus is a species of hawkfish widespread throughout the tropical waters of the Indo-West Pacific region.[1] A common species, it is found in rocky and coral areas of subtidal coastal reefs.

It can reach a maximum length of 12.5 cm (4.9 in).[2] It is a food fish for indigenous peoples and can also be found in the aquarium trade.[3] It is red-pink and white in color, and has tassels on the tip of its dorsal fin.

References[edit]

  1. ^ [1]
  2. ^ http://www.fishbase.org/summary/6604
  3. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Cirrhitichthys aprinus" in FishBase. April 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!