Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

A common species found in rocky and coral areas of subtidal coastal reefs (Ref. 9710). Enters shallow harbors and estuaries (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Indian Ocean: Maldives (Ref. 30829). Western Pacific.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10; Dorsal soft rays (total): 12; Analspines: 3; Analsoft rays: 6
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 125 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

12.5 cm TL (male/unsexed; (Ref. 2334))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Resemble C. oxycephalus but lacks spots on the tail and has a conspicuous opercular ocellus (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Cirrhitichthys aprinus
Catalog Number: USNM 98901
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Year Collected: 1908
Locality: Vicinity of Jolo., Jolo Lt., S. 16 deg. E., 0.85 mile., Jolo Island, Philippines, Sulu Archipelago, Pacific
Depth (m): 42
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range ? - 40 m (Ref. 9710), usually 12 - 20 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 50 specimens in 1 taxon.
Water temperature and chemistry ranges based on 26 samples.

Environmental ranges
  Depth range (m): 3.05 - 89.5
  Temperature range (°C): 23.278 - 27.250
  Nitrate (umol/L): 0.164 - 2.763
  Salinity (PPS): 34.925 - 35.493
  Oxygen (ml/l): 4.107 - 4.703
  Phosphate (umol/l): 0.147 - 0.316
  Silicate (umol/l): 0.380 - 5.767

Graphical representation

Depth range (m): 3.05 - 89.5

Temperature range (°C): 23.278 - 27.250

Nitrate (umol/L): 0.164 - 2.763

Salinity (PPS): 34.925 - 35.493

Oxygen (ml/l): 4.107 - 4.703

Phosphate (umol/l): 0.147 - 0.316

Silicate (umol/l): 0.380 - 5.767
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 40m.
Recorded at 40 meters.

Habitat: reef-associated. Collected at Aliwal - pers comm Elaine Heemstra E-mail 15 July 2002.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154). Feeds on benthic animals and fish (Ref. 275).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Pelagic spawner (Ref. 31569). Spawning ascents into the water column occurred over a distance of 0.3 to 0.6 m (Ref. 26305).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cirrhitichthys aprinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTGAGCTGGGATAGTCGGCACTGCCTTAAGCCTTCTCATTCGAGCTGAACTCAGCCAGCCAGGGGCCCTCCTGGGAGATGACCAAATTTATAATGTAATCGTTACAGCCCATGCATTTGTAATGATTTTTTTTATGGTTATACCAATTATAATTGGTGGCTTTGGAAACTGACTAATTCCCCTAATAATTGGAGCTCCTGATATAGCCTTCCCTCGAATAAATAATATAAGCTTCTGGCTTCTTCCCCCTTCCTTCTTACTTCTGCTAGCATCCTCTGGAGTTGAAGCAGGGGCAGGCACTGGATGAACAGTCTACCCCCCTCTAGCAGGCAACCTCGCCCATGCAGGAGCATCTGTAGATCTAACTATTTTCTCCCTTCATCTTGCAGGTATTTCTTCAATTTTAGGGGCTATTAATTTTATTACAACTATTATCAACATAAAACCCCCCTCTATTTCACAATATCAAACACCCCTATTTGTTTGAGCTGTCCTGATTACAGCAGTACTTCTTCTTCTATCCCTCCCAGTCCTTGCTGCCGGCATTACTATACTACTTACTGACCGGAATTTAAATACAACCTTCTTTGACCCTGCAGGGGGAGGAGACCCAATCCTTTATCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cirrhitichthys aprinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Spotted hawkfish

The spotted hawkfish, Cirrhitichthys aprinus is a species of hawkfish widspread throughout the tropical waters of the Indo-West Pacific region.[1] A common species, it is found in rocky and coral areas of subtidal coastal reefs.

It can reach a maximum length of 12.5 cm (4.9 in).[2] It is a food fish for indigenous peoples and can also be found in the aquarium trade.[3] It is red-pink and white in color, and has tassles on the tip of its dorsal fin.

References[edit]

  1. ^ [1]
  2. ^ http://www.fishbase.org/summary/6604
  3. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Cirrhitichthys aprinus" in FishBase. April 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!