Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

The Wedgetail Triggerfish (Rhinecanthus rectangulus) is a strikingly patterned reef fish found in the tropical and subtropical Indo-West Pacific from the Red Sea through Indonesia to the Marquesas Islands, north to southern Japan and south to Lord Howe Island. These fish can be found at depths to around 20 m around shallow coral or rocky reefs exposed to surge. They feed on corals and encrusting organisms, which they snap off with their strong teeth (the mouth is small, but both jaws bear strong incisors). (van der Elst 1993; Matsuura 2001)

Wedgetail Triggerfish have an orange snout and a bright blue band running over the upper jaw. A broad black or dark brown band extends diagonally across the body from the eye to the anal fin, completely separating the upper flanks from the head and pale chest. The caudal peduncle, at the base of the caudal (tail) fin has a black triangular blotch coming to a point below the middle of second the dorsal fin. The fins are dusky to translucent. The large, rounded pectoral fins (just behind the small, round gill openings) are marked with a fine vertically oriented curved orange bar. (van der Elst 1993; Matsuura 2001)

The somewhat angular body is covered with distinct rhomboid scales arranged in a regular "criss-cross" pattern. The modified scales running longitudinally on either side of the caudal peduncle carry five rows of short, sharp spikes. The first dorsal fin consists of three spines and the second consists of 22 to 24 rays. As with all triggerfishes, the first dorsal spine is very stout and can be locked into an upright position by the 2nd spine, or trigger. The spineless anal fin has 20 rays. The pelvic fins are reduced to a spiny projection at the lowest part of the body. Maximum length is around 25 cm. (van der Elst 1993; Matsuura 2001)

Wedgetail Triggerfish are easily approached underwater, but once alarmed the fish typically swims into a small crevice and lodge itself there by erecting its dorsal and pelvic spines (even if the tail remains exposed, the sharp caudal spikes offer some protection). If persistently harrassed, the triggerfish will repeat a series of short grunts. (van der Elst 1993)

Little is known about the breeding cycle of this species, but the fact that very small specimens are seen on reefs during the summer suggests a late winter spawning season. Wedgetail triggerfish are popular aquarium fish. They are easily caught on a small hook, but are not generally eaten. (van der Elst 1993) The Wedgetail Triggerfish is a familiar icon—and the official state fish-- in Hawaii, where it is known as the humuhumunukunukuapuaʻa. (Wikipedia [17 February 2012] and references therein)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Occur in shallow outer reefs subject to surge (Ref. 9770, 48637). Commonly found over barren rock or the spur-and-groove zone where there is a mixture of bare rock, rubble, and coral. Juveniles on algae reef (Ref. 48637). Benthopelagic (Ref. 58302). Feed on algae, detritus, mollusks, crustaceans, worms, echinoderms, fishes, sponges, foraminiferans, and eggs. Territorial. Oviparous (Ref. 205). Also taken by drive-in nets (Ref. 9770).
  • Matsuura, K. 2001 Balistidae. Triggerfishes. p. 3911-3928. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9770)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea south to East London, South Africa (Ref. 4420) and east through Indonesia to the Marquesan Islands, north to southern Japan, south to Lord Howe Island.
  • Matsuura, K. 2001 Balistidae. Triggerfishes. p. 3911-3928. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9770)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Seychelles, Madagascar and Mascarenes east to Pitcairn Group, north to Izu and Ogasawara islands, south to New Caledonia, Lord Howe Island and Kermadec Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 3; Dorsal soft rays (total): 22 - 25; Analspines: 0; Analsoft rays: 20 - 22
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

30.0 cm TL (male/unsexed; (Ref. 30573))
  • Sommer, C., W. Schneider and J.-M. Poutiers 1996 FAO species identification field guide for fishery purposes. The living marine resources of Somalia. FAO, Rome. 376 p. (Ref. 30573)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body orange-brown above; head and belly white; soft dorsal, anal and pectoral fins pale; caudal fin dusky (Ref. 4420).Description: Characterized by presence of black band through eye connecting expansive black area between pectoral and anal fin bases; caudal peduncle/posterior body with distinctive black triangular mark; absence of groove in front of eye; nearly straight dorsal and ventral profiles of head; caudal peduncle and adjacent posterior body with 4-5 horizontal rows of small, anterior projecting spines; rounded caudal fin (Ref. 90102).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Occurs in shallow outer reefs subject to surge (Ref. 9770). Commonly found over barren rock or the spur-and-groove zone where there is a mixture of bare rock, rubble, and coral. Feeds on algae, detritus, molluscs, crustaceans, worms, echinoderms, fishes, sponges, foraminiferans, and eggs. Territorial. Also taken by drive-in nets (Ref. 9770).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 10 - 20 m (Ref. 9770)
  • Matsuura, K. 2001 Balistidae. Triggerfishes. p. 3911-3928. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9770)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 10 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 1 - 59
  Temperature range (°C): 26.287 - 29.058
  Nitrate (umol/L): 0.045 - 1.522
  Salinity (PPS): 34.205 - 34.761
  Oxygen (ml/l): 4.406 - 4.549
  Phosphate (umol/l): 0.160 - 0.254
  Silicate (umol/l): 1.094 - 4.599

Graphical representation

Depth range (m): 1 - 59

Temperature range (°C): 26.287 - 29.058

Nitrate (umol/L): 0.045 - 1.522

Salinity (PPS): 34.205 - 34.761

Oxygen (ml/l): 4.406 - 4.549

Phosphate (umol/l): 0.160 - 0.254

Silicate (umol/l): 1.094 - 4.599
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 20m.
Recorded at 20 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Distinct pairing (Ref. 205).
  • Thresher, R.E. 1984 Reproduction in reef fishes. T.F.H. Publications, Inc. Ltd., Neptune City, New Jersey. 399 p. (Ref. 240)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhinecanthus rectangulus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTATACCTGATTTTCGGTGCTTGAGCTGGGATAGTAGGCACAGCCCTAAGCTTGCTAATCCGGGCAGAACTAAGCCAACCCGGCGCTCTCTTAGGCGATGACCAGATTTACAATGTCATCGTCACAGCACATGCTTTCGTTATAATTTTCTTTATAGTAATACCAATCATAATTGGCGGCTTCGGAAACTGACTAATTCCATTAATGATTGGGGCCCCCGATATAGCATTCCCCCGAATGAACAACATGAGCTTCTGACTTCTACCGCCTTCACTTCTACTACTTCTTGCCTCCTCAAGCGTAGAAGCCGGAGCTGGGACCGGATGAACGGTATATCCCCCTCTCGCAGGCAACCTAGCCCACGCGGGAGCCTCTGTTGACCTCACTATCTTCTCCCTCCACTTGGCAGGAATCTCATCAATTCTAGGGGCTATTAATTTTATTACAACGATTATTAATATGAAACCCCCAGCCATCTCTCAATATCAAACACCACTGTTTGTTTGAGCAGTTCTAATTACAGCAGTTCTTCTCCTCTTATCTCTCCCAGTCCTAGCTGCCGGAATTACAATACTACTTACCGATCGAAATCTAAACACCACATTCTTCGATCCTGCTGGAGGTGGAGACCCAATTCTCTATCAACATTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Rhinecanthus rectangulus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
  • Matsuura, K. 2001 Balistidae. Triggerfishes. p. 3911-3928. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9770)
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Reef triggerfish

"Humuhumunukunukuāpuaa" redirects here. For the Rhinecanthus aculeatus of the same name, see Lagoon triggerfish.

The reef, rectangular, or wedge-tail triggerfish, also known by its Hawaiian name, humuhumunukunukuāpuaʻa (pronounced [ˈhumuˈhumuˈnukuˈnukuˈwaːpuˈwɐʔə]), also spelled Humuhumunukunukuapua'a or just humuhumu for short; meaning "triggerfish with a snout like a pig."[1] is one of several species of triggerfish. Classified as Rhinecanthus rectangulus, it is endemic to the salt water coasts of various central and south Pacific Ocean islands. It is often asserted that the Hawaiian name is one of the longest words in the Hawaiian language and that "the name is longer than the fish."

Description[edit]

The triggerfish's teeth and top lip are blue and the teeth are set close together inside its relatively chubby mouth. It has a small second spine, which it can use to lock its main spine into an upright position. The triggerfish can wedge itself into small crevices and lock its spine to make it extremely difficult to get out. In addition, when fleeing from predators, the triggerfish will sometimes make grunting noises, possibly a call to warn other nearby triggerfish of danger.[2] One particularly interesting aspect of the fish's behavior is the ability to blow jets of water from its mouth. These jets help the fish find benthic invertebrates that may be buried under the substrate. Triggerfish can often be seen spitting sand from their mouths in order to sift through the material in search of edible detritus or organisms. Reef triggers are fairly aggressive and will generally not tolerate conspecific individuals in their general vicinity; thus the fish is often found solitary. This is particularly true in captivity. Triggers have the remarkable ability to rapidly alter their coloration. They can fade into a relatively drab appearance when sleeping or demonstrating submission, while their coloration is often the most vivid when the fish are healthy and unthreatened by their surroundings.

Distribution[edit]

The reef triggerfish is distributed throughout the Indo-Pacific region. It is especially prominent in the coral reefs of the Hawaiian Islands.

Hawaii state fish[edit]

Humuhumunukunukuapua'a at Kealakekua Bay, Hawaii

The reef triggerfish was originally designated the official fish of Hawaii in 1985,[3] but due to an expiration of a Hawaiian state law after five years, it ceased to be the state fish in 1990.[4] On April 17, 2006, bill HB1982 was presented to the Governor of Hawaiʻi, which permanently reinstated the reef triggerfish (humuhumunukunukuapuaʻa) as the state fish of Hawaiʻi.[5] The bill passed into law on May 2, 2006, and was effective upon its approval.[6][7]

In popular culture[edit]

A reef triggerfish appeared (in animated form) in the Star Trek: The Next Generation episode "Rascals". The image of the fish is used as the avatar for the Enterprise children's classroom computer.

Reef triggerfish are the focal sea creature in episode 49 of the Octonauts animated children's show.

Mentioned in the 2008 motion picture Forgetting Sarah Marshall. [8]

Notes[edit]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!