You are viewing this Taxon as classified by:

Overview

Comprehensive Description

Biology

A coral-commensal species (Ref. 72446).
  • Larson, H.K. and E.O. Murdy 2001 Gobiidae. Gobies. p. 3578-3603. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 42915)   http://www.fishbase.org/references/FBRefSummary.php?id=42915&speccode=7220 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Central Pacific.
  • Larson, H.K. and E.O. Murdy 2001 Gobiidae. Gobies. p. 3578-3603. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 42915)   http://www.fishbase.org/references/FBRefSummary.php?id=42915&speccode=7220 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 12 specimens in 1 taxon.
Water temperature and chemistry ranges based on 11 samples.

Environmental ranges
  Depth range (m): 0.9 - 8.5
  Temperature range (°C): 22.368 - 28.954
  Nitrate (umol/L): 0.087 - 0.923
  Salinity (PPS): 34.131 - 35.552
  Oxygen (ml/l): 4.525 - 5.079
  Phosphate (umol/l): 0.113 - 0.166
  Silicate (umol/l): 0.983 - 2.486

Graphical representation

Depth range (m): 0.9 - 8.5

Temperature range (°C): 22.368 - 28.954

Nitrate (umol/L): 0.087 - 0.923

Salinity (PPS): 34.131 - 35.552

Oxygen (ml/l): 4.525 - 5.079

Phosphate (umol/l): 0.113 - 0.166

Silicate (umol/l): 0.983 - 2.486
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gobiodon ceramensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACTTAGTCTTTGGTGCCTGAGCCGGAATAGTGGGGACCGCTCTGAGCCTGCTCATTCGAGCCGAGCTTAGTCAACCCGGGGCCCTGCTTGGGGACGACCAGGTTTATAATGTGATCGTTACTGCCCACGCATTCGTAATGATCTTCTTTATAGTAATGCCAATCATGATCGGAGGGTTTGGAAACTGACTTATCCCCCTAATGATCGGGGCCCCCGACATAGCTTTCCCTCGAATGAATAATATGAGCTTCTGGCTTCTTCCTCCTTCTTTTCTTCTCCTACTGGCATCCTCAGGGGTCGAAGCGGGGGCAGGAACAGGGTGAACTGTATACCCCCCACTAGCGGGCAACCTGGCACACGCCGGAGCATCCGTTGACTTAACTATCTTTTCTCTTCATCTTGCAGGGATTTCTTCTATTCTAGGAGCAATTAACTTCATTACTACGATTCTTAACATGAAACCTCCTGCCATCTCTCAGTATCAAACGCCCCTGTTCGTTTGAGCTGTCCTTATTACAGCGGTCCTACTACTCCTCTCTCTTCCCGTCCTTGCTGCCGGAATTACAATGCTTCTCACAGACCGAAACCTCAATACAACCTTCTTTGACCCTGCGGGCGGAGGGGACCCCATCCTGTACCAGCACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gobiodon ceramensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!