You are viewing this Taxon as classified by:

Overview

Comprehensive Description

Biology

A coral-commensal species (Ref. 72446). Found among branches of hard corals in 2-15 m, often with Stylophora pistillata (Ref 90102).
  • Larson, H.K. and E.O. Murdy 2001 Gobiidae. Gobies. p. 3578-3603. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 42915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Central Pacific.
  • Larson, H.K. and E.O. Murdy 2001 Gobiidae. Gobies. p. 3578-3603. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 42915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 6 - 7; Dorsal soft rays (total): 10; Analspines: 1; Analsoft rays: 8 - 9
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

3.5 cm TL (male/unsexed; (Ref. 90102))
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Characterized by uniform black body color including fins; absence of scales; complete pelvic fin frenum and basal membrane; depth of body at pelvic fin level 3.0-3.5 in SL (Ref 90102).
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 2 - 15 m (Ref. 90102)
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 12 specimens in 1 taxon.
Water temperature and chemistry ranges based on 11 samples.

Environmental ranges
  Depth range (m): 0.9 - 8.5
  Temperature range (°C): 22.368 - 28.954
  Nitrate (umol/L): 0.087 - 0.923
  Salinity (PPS): 34.131 - 35.552
  Oxygen (ml/l): 4.525 - 5.079
  Phosphate (umol/l): 0.113 - 0.166
  Silicate (umol/l): 0.983 - 2.486

Graphical representation

Depth range (m): 0.9 - 8.5

Temperature range (°C): 22.368 - 28.954

Nitrate (umol/L): 0.087 - 0.923

Salinity (PPS): 34.131 - 35.552

Oxygen (ml/l): 4.525 - 5.079

Phosphate (umol/l): 0.113 - 0.166

Silicate (umol/l): 0.983 - 2.486
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gobiodon ceramensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACTTAGTCTTTGGTGCCTGAGCCGGAATAGTGGGGACCGCTCTGAGCCTGCTCATTCGAGCCGAGCTTAGTCAACCCGGGGCCCTGCTTGGGGACGACCAGGTTTATAATGTGATCGTTACTGCCCACGCATTCGTAATGATCTTCTTTATAGTAATGCCAATCATGATCGGAGGGTTTGGAAACTGACTTATCCCCCTAATGATCGGGGCCCCCGACATAGCTTTCCCTCGAATGAATAATATGAGCTTCTGGCTTCTTCCTCCTTCTTTTCTTCTCCTACTGGCATCCTCAGGGGTCGAAGCGGGGGCAGGAACAGGGTGAACTGTATACCCCCCACTAGCGGGCAACCTGGCACACGCCGGAGCATCCGTTGACTTAACTATCTTTTCTCTTCATCTTGCAGGGATTTCTTCTATTCTAGGAGCAATTAACTTCATTACTACGATTCTTAACATGAAACCTCCTGCCATCTCTCAGTATCAAACGCCCCTGTTCGTTTGAGCTGTCCTTATTACAGCGGTCCTACTACTCCTCTCTCTTCCCGTCCTTGCTGCCGGAATTACAATGCTTCTCACAGACCGAAACCTCAATACAACCTTCTTTGACCCTGCGGGCGGAGGGGACCCCATCCTGTACCAGCACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gobiodon ceramensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!