Overview

Brief Summary

North American Ecology (US and Canada)

Poanes zabulon is a year-round resident in the southeastern United States west to the Mississippi River, and as a separate, patchily-distributed population in the southwestern ?four corners? states, Texas and south to Panama (Scott 1986). Habitats are open woods in the east, valley bottoms and high-plains cottonwood in the west. Host plants are grasses. There are variable numbers of flights each year depending on location: one flight in the western U.S., with the approximate flight time June 15-July 31, two flights with the approximate flight times late May-early July and Aug.15-Sept. 15 in the northeast, and several flights between April.1-Sept. 15 in the southeastern part of their range (Scott 1986). Some sources consider these two populations separate species, P. zabulon and P. taxiles, others consider them subspecies of P. zabulon (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Poanes zabulon is a "skipper" butterfly in the family Hesperiidae. It has a thick, hairy body and hooked antennae, appearing to some more like a moth.

P. zabulon is small, with a wing span of 1 3/8 - 1 5/8 inches (3.5 - 4.2 cm). Males have black borders and no stigma, with the underside of their hindwings mostly yellow with a dark brown wingbase and outer margin. The upperside of females are purple-brown with pale yellow spots, with hindwing undersides that are brown and purple-gray with a white-edged costal margin.

Favoring brushy openings near moist forests and streams, P. zabulon ranges from Massachusetts west through southern Michigan to central Kansas; south to central Florida, southern Louisiana, and northeast Texas. Strays to New Mexico, South Dakota, and southern Quebec. A separate population ranges from central Mexico south to Panama. They are on the move from March to April and again in August to October in the south; and from May to July and again in August to September in the north.

They are nectar feeders from plants such as the Japanese honeysuckle, red clover, everlasting pea, and selfheal, in addition to blackberry, purple vetch, common milkweed, buttonbush, joe-pye weed, and thistles.

When at rest, most species of butterflies perch with both pairs of wings closed or with both pairs of wings open (horizontal). This includes many skippers especially the spread wing skippers (subfamily Pyrginae). The other common position, the so called "jet plane position", is used mainly by the grass skippers (subfamily Hesperiinae) In this position the hindwings are held lower than the forewings, which are held up at an angle but not vertical (Curtis 2012).

Public Domain

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Comments: Openings, natural or otherwise in dry to moist woods; shaded weedy lawns and city parks; brushy areas; shaded edges of fields etc.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Flowering Plants Visited by Poanes zabulon in Illinois

Poanes zabulon Boisduval & LeConte: Hesperiidae, Lepidoptera
(observations are from Robertson, Graenicher, the Hilton Pond Center, Macior, Fothergill & Vaughn; this is the Zabulon Skipper)

Asteraceae: Cirsium vulgare sn (Rb), Coreopsis palmata sn (Rb), Senecio aureus sn (Gr), Silphium perfoliatum sn (Rb), Solidago juncea sn (Gr), Taraxacum officinale sn (FV); Caprifoliaceae: Lonicera reticulata sn (Gr); Convolvulaceae: Ipomoea pandurata sn (Rb); Cornaceae: Cornus obliqua sn (Rb); Hydrophyllaceae: Hydrophyllum appendiculatum sn (Rb); Lamiaceae: Glechoma hederacea sn np (Rb), Monarda bradburiana sn (Rb), Monarda fistulosa sn (Rb), Scutellaria incana sn np (Rb); Liliaceae: Smilacina stellata sn (Gr); Polemoniaceae: Phlox divaricata laphamii sn fq (Rb); Pontederiaceae: Pontederia cordata sn (HPC); Ranunculaceae: Delphinium tricorne sn np (Rb, Mc); Rosaceae: Rubus allegheniensis sn (Rb), Rubus flagellaris sn (Rb); Rubiaceae: Cephalanthus occidentalis sn (Rb); Scrophulariaceae: Dasistoma macrophylla sn fq np (Rb), Penstemon hirsutus sn np (Rb)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Adults sip flower nectar and mud. Males perch for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Poanes zabulon

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGATTATTAATTCGTACAGAATTAGGTAATCCTGGATCTTTAATCGGAGATGATCAAATTTATAACACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCCCCTGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTTGAATACTACCCCCCTCACTAACATTATTAATTTCAAGAAGAATCGTAGAAAATGGTGCAGGAACAGGTTGAACTGTTTACCCCCCCTTATCATCTAATATTGCTCATCAAGGATCCTCAGTCGATTTGACAATTTTTTCTCTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTAATGTTTGACCAAATACCTTTATTTGTATGATCTGTAGGTATTACAGCTTTATTATTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTACTTACCGATCGAAATTTAAATACTTCATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Poanes zabulon

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Zabulon Skipper

The Zabulon Skipper, Poanes zabulon, (sometimes called the Southern Dimorphic Skipper[1]) is a North American butterfly first described by the French naturalists Jean Baptiste Boisduval and John Eatton Le Conte from the state of Georgia, United States.

Description[edit]

Upper side of the male

This small butterfly has slim, triangular wings. The upper side of the male's wings is mostly orange with the margins being dark brown. The underside of the male's wings is mainly yellow-orange with the margins being dark brown.[2] There is a yellow basal spot enclosed with brown.[3] The upper side of the female's wings is dark brown with large, glassy spots near the fore wing outer margin. The underside of the female's wings is a brownish-burgundy color with the hind wing having a white streak on the costal edge. The wing margins are broadly frosted.[2] The wingspan measures 1⅜ to 1⅝ inches.[4]

Similar species[edit]

Underside of the male
Upper side of the female

The only similar species in the Zabulon Skipper's range is the Hobomok Skipper.

The Hobomok Skipper has a more northern range and different flight period than the Zabulon Skipper. They also have more rounded wings. The upper side of the male Hobomok Skipper's wings has thicker dark margins. The underside of the male's hind wing lacks the enclosed yellow basal spot.[3] While the female Zabulon Skipper has one form, the female Hobomok Skipper has two; the normal form and the pocahontas form. The upper side of the pocahontas form has smaller glassy spots and has one glassy spot near the fore wing costa.[2]

Distribution[edit]

It ranges from Wisconsin east to the East Coast, south to Georgia, Texas, and Panama.

Habitat[edit]

The Zabulon Skipper can be found in a wide range of habitats such as woodland edges, woodland openings, and near roads, especially if there are streams nearby. It can adapt to other habitats including suburban areas, parks, and gardens.[2]

Flight[edit]

This butterfly is on the wing from March to April and again in August to October in the south; and from May to July and again in August to September in the north.[2]

Life cycle[edit]

Males perch all day in search for females. Usually, courtship takes place in the afternoon. However, it will occasionally happen as early as 8:20 A.M.[2] Females lay their eggs singly on the underside of host plant leaves.[1] The larva is either brown or green, both sometimes having a pinkish hue. It is often indistinguishable from closely related larvae[5] The chrysalis is often formed inside a leaf shelter. It is brown with the abdomen being a lighter brown and having small black dots.[1] The overwintering stage is unknown.[2] The Zabulon Skipper has 2 broods per year.[3]

Host plants[edit]

Recorded food plants of the caterpillars are grasses such as Agrostis, Dactylis, Elytrigia, Eragrostis, Leymus, Poa, Puccinellia and Tridens.

References[edit]

  1. ^ a b c James A. Scott (1986). The Butterflies of North America. Stanford University Press, Stanford, CA. ISBN 0-8047-2013-4
  2. ^ a b c d e f g Rick Cech and Guy Tudor (2005). Butterflies of the East Coast. Princeton University Press, Princeton, NJ. ISBN 0-691-09055-6
  3. ^ a b c Jim P. Brock and Kenn Kaufman (2003). Butterflies of North America. Houghton Mifflin, New York, NY. ISBN 0618768262
  4. ^ "Zabulon Skipper,"
  5. ^ Allen J. Thomas, Jim P. Brock, and Jeffrey Glassberg (2005). Caterpillars in the Field and Garden. Oxford University Press, New York, NY. ISBN 978-0-19-514987-6
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!