Overview

Comprehensive Description

Biology

Common in clear outer lagoon and seaward reefs, over hard bottoms as well as over sand and rubble. Typical along reef-crests in depths of 1-6 m, but has also been collected from depths of 24 m. Usually seen in pairs, hovering near their burrow. Monogamous (Ref. 52884, 48637). Feeds on small benthic invertebrates, fishes, and fish eggs by sifting mouthfuls of sand.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa to Tuamoto Islands, north to the Ryukyu Islands, south to Sydney, Australia, including Lord Howe Island.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: South Africa, East Africa, Seychelles, Madagascar and Mascarenes east to Line Islands, Society Islands and Marquesas Islands, north to southern Japan, south to Western Australia, Lord Howe Island, New Caledonia and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 17 - 19; Analspines: 1; Analsoft rays: 16 - 19
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 180 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

18.0 cm TL (male/unsexed; (Ref. 2798)); max. reported age: 1 years (Ref. 56281)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Common in clear outer lagoon and seaward reefs, over hard bottoms as well as over sand and rubble. Typical along reef-crests in depths of 1-6 m, but has also been collected from depths of 24 m. Usually seen in pairs, hovering near their burrow. Feeds on small benthic invertebrates, fishes, and fish eggs by sifting mouthfuls of sand.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Curved bar from below eye to opercle (Ref. 2798).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 25 m (Ref. 48637), usually 1 - 6 m (Ref. 8527)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 66 specimens in 1 taxon.
Water temperature and chemistry ranges based on 33 samples.

Environmental ranges
  Depth range (m): 0.15 - 22
  Temperature range (°C): 25.245 - 29.264
  Nitrate (umol/L): 0.045 - 2.714
  Salinity (PPS): 32.279 - 35.383
  Oxygen (ml/l): 4.484 - 4.812
  Phosphate (umol/l): 0.094 - 0.507
  Silicate (umol/l): 0.819 - 4.452

Graphical representation

Depth range (m): 0.15 - 22

Temperature range (°C): 25.245 - 29.264

Nitrate (umol/L): 0.045 - 2.714

Salinity (PPS): 32.279 - 35.383

Oxygen (ml/l): 4.484 - 4.812

Phosphate (umol/l): 0.094 - 0.507

Silicate (umol/l): 0.819 - 4.452
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 24m.
From 1 to 24 meters.

Habitat: reef-associated. Pennant glider.  (Broussonet, 1787) Attains 18 cm. A small elongate fish with a light grey body and a distinctive black edged blue stripe below the eye. The front and lower portion of the head is yellow and the first dorsal has extended spiny rays. A fairly common goby found on sandy bottoms with loose rocks near the edge of reefs. Ranges in depth from 1 - 25 metres. Often seen in pairs hovering near their burrows which they dart back into when approached. They are constantly digging in the sand and sifting sand through their gills for food particles. Indo-Pacific south to Sodwana Bay in Northern Natal, South Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Common in clear outer lagoon and seaward reefs, over hard bottoms as well as over sand and rubble. Typical along reef-crests in depths of 1-6 m, but has also been collected from depths of 24 m. Usually seen in pairs, hovering near their burrow. Monogamous (Ref. 52884, 48637). Feeds on small benthic invertebrates, fishes, and fish eggs by sifting mouthfuls of sand.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Metacercaria Infection (Flatworms). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Distinct pairing (Ref. 56363). Females spawn every 13 days while males guard the eggs which are laid in a burrow for 2-3 days (Ref. 56363). Both sexes impose monogamy as a practise by guarding each other against other possible mates (Ref. 56363). Mate guarding is made possible because all males were able to hold a nest site, both sexes exhibit strong site fidelity, and residents have an advantage in contests over mates (Ref. 56363).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Valenciennea strigata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTATCTAGTATTTGGTGCCTGAGCCGGAATAATTGGCACTGCCCTAAGCCTGCTTATTCGAGCCGAGTTGAGCCAGCCCGGTGCACTGCTCGGAGACGACCAAATTTACAATGTGATCGTTACCGCCCACGCATTTGTAATAATCTTCTTTATAGTAATGCCAATCATGATTGGGGGCTTTGGAAACTGACTTATTCCTCTAATGATCGGTGCCCCCGACATAGCTTTCCCACGAATGAACAATATGAGCTTCTGGCTCTTGCCCCCTTCTTTCTTACTCCTGTTAGCCTCCTCTGGGGTCGAAGCCGGAGCGGGAACAGGGTGAACTGTTTACCCGCCCCTCGCCGGCAACCTAGCTCACGCTGGGGCCTCCGTAGACCTAACAATTTTTTCCCTGCATCTGGCCGGTATTTCCTCCATTTTAGGTGCAATTAATTTTATTACAACCATTTTAAACATAAAACCTCCAGCCATCTCTCAGTACCAAACGCCCCTGTTTGTGTGAGCAGTACTAATTACCGCTGTCCTGCTTCTTCTCTCTCTCCCAGTCCTTGCTGCAGGCATTACAATGCTCCTTACGGACCGAAACCTAAATACAACATTCTTCGACCCTGCAGGAGGAGGGGATCCAATCCTCTATCAGCACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Valenciennea strigata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Valenciennea strigata

Valenciennea strigata, the Blueband goby, is a species of goby native to the Indian Ocean and the western Pacific Ocean where it can be found in outer lagoons and the seaward side of reefs It inhabits a variety of substrates, sand, rubble, hard, at depths of from 1 to 25 metres (3.3 to 82 ft) (usually at less than 6 metres (20 ft)). This species can reach a length of 18 centimetres (7.1 in) TL. It can also be found in the aquarium trade.[1]

Aquarium Keeping[edit]

The Golden-headed Sleeper Goby, Blueband Goby, or Pennant Glider are not only pretty fish, but are great for a marine environment where you want the substrate to constantly be sifted through. These fish really use their mouths! They are constantly digging and turning over the sandy substrate. Besides this ongoing activity of "chewing" the sand, these gobies can communicate with each other by producing signals with their mouths.

Maintenance Difficulty[edit]

The Golden-headed Sleeper Goby, Blueband Goby, or Pennant Glider are moderately difficult to keep, considered good for a more experienced aquarist with a larger system, where they can find plenty to eat. Like other members of the Valenciennea species, they feed by taking up mouthfuls of sand and pass it through their gill covers to extract small crustaceans, worms and algae. It is important that they have a sufficient amount of "live" sand for them to sift through.

Maintenance/Foods[edit]

A typical goby, they eat small crustaceans and other small marine organisms. Live brine and a high protein krill are ideal for the aquarium. This fish thrives on nearly all marine frozen foods, live and flake foods once feeding.

Social Behaviors[edit]

They live in pairs and like to burrow in the sand, especially juveniles.They are peaceful with other fish especially their own kind and may be considered safe to keep in pairs or small groups where space and filtration capacity allows

References[edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Valenciennea strigata" in FishBase. June 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!