Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

A solitary species found on sandy bottoms near rocky or coral reefs (Ref. 12951). Usually found in deeper water but moves onto the reef flat and into shallow lagoons at high tide (Ref. 12951). Occasionally covers itself with sand, leaving only its eyes and tail visible (Ref. 37816). Feeds on crabs and shrimps (Ref. 5578). Ovoviviparous (Ref. 50449). The venomous spine can inflict a painful wound (Ref.4690). Caught in very large quantities in the bottom trawl, trammel and fish trap fisheries. Utilized for its meat but of limited value due to its small size (Ref.58048).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

An apparently wide ranging species found from the Western Indian Ocean to the Eastern Pacific. However, this is considered a species-complex and more than five species in total may be involved. Taxonomic investigation will be vital to identify the species involved and their true distributions (W. White pers. obs. 2007). Reported from: American Samoa, Australia, Cambodia, Cook Islands, Guam, China (Hong Kong), Taiwan, Province of China, India, Indonesia, Japan, Ogasawara Islands, Madagascar, Malaysia, Mauritius, Micronesia, Mozambique, Myanmar, Marianas, New Caledonia, Palau, Papa New Guinea, Philippines, Samoa, Somalia, South Africa, Sri Lanka, Tanzania, Thailand, Tonga, Vanuatu, Vietnam and Yemen (Compagno 1986).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: Red Sea (Ref. 9840) and East Africa to Samoa (Ref. 592) and Tonga (Ref. 53797), north to Japan, south to Australia (Ref. 9840). Represented by multiple color morphs in the Indo-Pacific which may be different species (Ref. 9840).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Durban (South Africa), Madagascar and Mauritius (Mascarenes) east to Philippines and Mariana Islands, north to Hokkaido (Japan), south to Western Australia at 25°31'S, New South Wales (Australia) and New Caledonia
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Durban (South Africa), Madagascar and Mauritius (Mascarenes) east to Philippines and Mariana Islands, north to Hokkaido (Japan), south to Western Australia at 25°31'S, New South Wales (Australia) and New Caledonia
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 700 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

70.0 cm TL (male/unsexed; (Ref. 5578))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Reddish brown with blue centered bright ocelli and scattered black spots dorsally, white ventrally (Ref. 3263). Snout very short and broadly angular; disc angular; tail as long as body with conspicuous black and white rings, and with a short upper caudal finfold but a longer lower one ending well behind tail tip; disc without thorns; usually one sting on tail (Ref. 5578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
A demersal species found on sandy bottoms near rocky or coral reefs at depths of 0?90 m (White et al. 2006). This species is usually found in deeper water but moves onto the reef flat and into shallow lagoons at high tide (Michael 1993). In Indonesia, this species often occurs on sandy mud bottom (Fahmi pers. obs. 2007). It occasionally covers itself with sand, leaving only its eyes and tail visible (Myers 1999).

Size parameters differ between regions and areas because this is most likely a complex of more than five species. The Java form attains at least 38cm disc width (DW), with males maturing at 22?26 cm DW and females at 23?27 cm DW (White et al. 2006, White and Dharmadi 2007). Size at birth for the Java form is 11?16 cm (White et al. 2006). The Bali form attains at least 45 cm DW, with males maturing at 31?35 cm DW (White et al. 2006, White and Dharmadi 2007). Size at birth for the Bali form is ~17 cm. Reproduction is viviparous, with histotrophy. Java and Bali forms give birth to litters of 1?2 pups after an unknown gestation period and there is apparently no reproductive synchronicity (White et al. 2006). Dasyatis kuhlii feeds on crabs and shrimps (Compagno et al. 1989).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 0 - 90 m (Ref. 9840)
  • Last, P.R. and L.J.V. Compagno 1999 Dasyatididae. Stingrays. p. 1479-1505. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 3. Batoid fishes, chimaeras and bony fishes part 1 (Elopidae to Linophrynidae). FAO, Rome. (Ref. 9840)   http://www.fishbase.org/references/FBRefSummary.php?id=9840&speccode=15387 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 334 specimens in 1 taxon.
Water temperature and chemistry ranges based on 188 samples.

Environmental ranges
  Depth range (m): 1 - 168.5
  Temperature range (°C): 22.185 - 28.783
  Nitrate (umol/L): 0.048 - 9.599
  Salinity (PPS): 33.355 - 37.794
  Oxygen (ml/l): 3.230 - 4.705
  Phosphate (umol/l): 0.100 - 0.783
  Silicate (umol/l): 0.567 - 12.243

Graphical representation

Depth range (m): 1 - 168.5

Temperature range (°C): 22.185 - 28.783

Nitrate (umol/L): 0.048 - 9.599

Salinity (PPS): 33.355 - 37.794

Oxygen (ml/l): 3.230 - 4.705

Phosphate (umol/l): 0.100 - 0.783

Silicate (umol/l): 0.567 - 12.243
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 90m.
Recorded at 90 meters.

Habitat: reef-associated. Bluespotted stingray.  (Muller & Henle, 1841)  Attains 70 cm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits sandy areas among coral reefs. A solitary species found on sandy bottoms near rocky or coral reefs (Ref. 12951). Usually found in deeper water but moves onto the reef flat and into shallow lagoons at high tide (Ref. 12951). Occasionally covers itself with sand, leaving only its eyes and tail visible (Ref. 37816). Feeds on crabs and shrimps (Ref. 5578). A carnivore (Ref. 9137). Also Ref. 58534.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Exhibit ovoviparity (aplacental viviparity), with embryos feeding initially on yolk, then receiving additional nourishment from the mother by indirect absorption of uterine fluid enriched with mucus, fat or protein through specialised structures (Ref. 50449). Distinct pairing with embrace (Ref. 205). Litters size at birth 16 cm (Ref. 37816); Java form born at 11-16 cm WD, Bali form born at ~17 cm WD. Gives birth to litters of 1-2 pups; no reproductive synchronicity (Ref. 58048).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Neotrygon kuhlii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 80
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Neotrygon kuhlii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACTTAGTCTTTGGTGCATGAGCAGGGATAGTAGGCACTGGCCTCAGTTTACTTATCCGAACAGAATTAAGCCAACCAGGTGCTTTACTGGGTGATGATCAAATTTATAATGTTATCGTTACTGCCCACGCCTTCGTAATAATCTTCTTTATAGTAATGCCAATTATAATTGGTGGGTTTGGTAACTGACTAGTGCCCCTGATAATTGGGGCTCCGGACATAGCCTTTCCACGAATAAACAACATAAGTTTTTGACTTCTGCCCCCCTCATTCCTATTACTGCTAGCCTCAGCAGGAGTAGAAGCCGGAGCTGGAACAGGTTGAACAGTTTATCCCCCATTAGCCGGTAATCTAGCACATGCCGGAGCTTCTGTAGATCTTACAATCTTCTCTCTTCACCTAGCAGGTGTTTCCTCTATTCTGGCATCCATCAACTTTATCACAACAATTATTAATATAAAACCACCTGCAATCTCCCAGTATCAAACCCCATTATTCGTCTGATCTATTCTTGTTACAACTGTACTTCTCCTGCTATCCCTACCAGTCCTAGCAGCTGGCATTACTATACTCCTCACAGATCGAAATCTTAATACAACTTTCTTCGACCCAGCTGGAGGAGGGGATCCCATTCTTTACCAACACCTCNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Ocean Genome Legacy
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Fahmi & White, W.

Reviewer/s
Valenti, S.V. & Séret, B. (Shark Red List Authority)

Contributor/s

Justification
Bluespotted Stingray (Dasyatis kuhlii) is reported throughout a wide range from the western Indian Ocean to the eastern Pacific, but may be a complex of more than five species. Investigation is vital to resolve the taxonomic issues associated with this species complex and it is not possible to assess it beyond Data Deficient at present. The Bluespotted Stingray is taken as utilized bycatch of bottom trawl, trammel net and fish trap fisheries in many parts of its range. It is relatively common and possibly more resilient than some of the other larger ray species in parts of its known range, for example Indonesia. It is also exhibited in some public aquariums, but does not constitute a major species in aquarium trade. Further work is required to identify the species involved and make full assessments of their status.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Population size in Indonesia is still unknown. Market observations were conducted at several landing sites in Java and Kalimantan from 2005 to present, and showed that the species is quite common. They were recorded at almost all landing sites (fishing areas including the Java Sea, off southern Java (Indian Ocean), Sunda Strait, Karimata Strait, Makassar Strait, West Kalimantan, Natuna Islands) (Authors pers. obs. 2007).

Extensive surveys of various fish landings sites in eastern Indonesia, conducted between April 2001 and March 2006 recorded a total of 28,385 individual batoids, comprising 54 species belonging to 12 families. The Java form of D. kuhlii contributed 42.7% by number to the total number of batoids recorded and only 3.9% by biomass. The Bali form of D. kuhlii contributed 3.4% by number to the total number of batoids recorded and only 0.7 by biomass (White and Dharmadi 2007).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
This species is of commercial interest to fisheries throughout its range. It is also taken from the wild for use in aquariums (Compagno 1986).

In Indonesia, this species is caught as utilized bycatch in trawl, trammel net and Danish seine fisheries targeting mixed demersal fishes. It is commonly caught in large numbers by trawl and Danish seine boats operating in the Java Sea. This species is the second most important elasmobranch caught by the Danish seine fishery according to the total catch (biomass) and is the principle elasmobranch in terms of the total number of individuals (contributing ~ 700 kg/boat in average) (Fahmi pers. obs. 2007). According to anecdotal observations of artisanal fisheries catches in Java during August 2006?May 2007, the production of D. kuhlii increased (from 231 kg/boat in August 2006, to 724 kg/boat in May 2007). Total production of rays in Indonesian fishery statistics also showed an increasing trend (DGCF 2005).

It is utilised for its meat but of limited value due to its small size. The meat is often smoked and salted or dried for marketing locally. This is a relatively small ray and it may, possibly, be more resilient to depletion in fisheries than some of the other larger ray species in parts of its known range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
None currently in place. Research is required on taxonomy and population trends.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!