Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

A solitary species found on sandy bottoms near rocky or coral reefs (Ref. 12951). Usually found in deeper water but moves onto the reef flat and into shallow lagoons at high tide (Ref. 12951). Occasionally covers itself with sand, leaving only its eyes and tail visible (Ref. 37816). Feeds on crabs and shrimps (Ref. 5578). Ovoviviparous (Ref. 50449). The venomous spine can inflict a painful wound (Ref.4690). Caught in very large quantities in the bottom trawl, trammel and fish trap fisheries. Utilized for its meat but of limited value due to its small size (Ref.58048).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

An apparently wide ranging species found from the Western Indian Ocean to the Eastern Pacific. However, this is considered a species-complex and more than five species in total may be involved. Taxonomic investigation will be vital to identify the species involved and their true distributions (W. White pers. obs. 2007). Reported from: American Samoa, Australia, Cambodia, Cook Islands, Guam, China (Hong Kong), Taiwan, Province of China, India, Indonesia, Japan, Ogasawara Islands, Madagascar, Malaysia, Mauritius, Micronesia, Mozambique, Myanmar, Marianas, New Caledonia, Palau, Papa New Guinea, Philippines, Samoa, Somalia, South Africa, Sri Lanka, Tanzania, Thailand, Tonga, Vanuatu, Vietnam and Yemen (Compagno 1986).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: Red Sea (Ref. 9840) and East Africa to Samoa (Ref. 592) and Tonga (Ref. 53797), north to Japan, south to Australia (Ref. 9840). Represented by multiple color morphs in the Indo-Pacific which may be different species (Ref. 9840).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Durban (South Africa), Madagascar and Mauritius (Mascarenes) east to Philippines and Mariana Islands, north to Hokkaido (Japan), south to Western Australia at 25°31'S, New South Wales (Australia) and New Caledonia
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Durban (South Africa), Madagascar and Mauritius (Mascarenes) east to Philippines and Mariana Islands, north to Hokkaido (Japan), south to Western Australia at 25°31'S, New South Wales (Australia) and New Caledonia
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 700 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

70.0 cm TL (male/unsexed; (Ref. 5578))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Reddish brown with blue centered bright ocelli and scattered black spots dorsally, white ventrally (Ref. 3263). Snout very short and broadly angular; disc angular; tail as long as body with conspicuous black and white rings, and with a short upper caudal finfold but a longer lower one ending well behind tail tip; disc without thorns; usually one sting on tail (Ref. 5578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
A demersal species found on sandy bottoms near rocky or coral reefs at depths of 0?90 m (White et al. 2006). This species is usually found in deeper water but moves onto the reef flat and into shallow lagoons at high tide (Michael 1993). In Indonesia, this species often occurs on sandy mud bottom (Fahmi pers. obs. 2007). It occasionally covers itself with sand, leaving only its eyes and tail visible (Myers 1999).

Size parameters differ between regions and areas because this is most likely a complex of more than five species. The Java form attains at least 38cm disc width (DW), with males maturing at 22?26 cm DW and females at 23?27 cm DW (White et al. 2006, White and Dharmadi 2007). Size at birth for the Java form is 11?16 cm (White et al. 2006). The Bali form attains at least 45 cm DW, with males maturing at 31?35 cm DW (White et al. 2006, White and Dharmadi 2007). Size at birth for the Bali form is ~17 cm. Reproduction is viviparous, with histotrophy. Java and Bali forms give birth to litters of 1?2 pups after an unknown gestation period and there is apparently no reproductive synchronicity (White et al. 2006). Dasyatis kuhlii feeds on crabs and shrimps (Compagno et al. 1989).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 0 - 90 m (Ref. 9840)
  • Last, P.R. and L.J.V. Compagno 1999 Dasyatididae. Stingrays. p. 1479-1505. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 3. Batoid fishes, chimaeras and bony fishes part 1 (Elopidae to Linophrynidae). FAO, Rome. (Ref. 9840)   http://www.fishbase.org/references/FBRefSummary.php?id=9840&speccode=15387 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 334 specimens in 1 taxon.
Water temperature and chemistry ranges based on 188 samples.

Environmental ranges
  Depth range (m): 1 - 168.5
  Temperature range (°C): 22.185 - 28.783
  Nitrate (umol/L): 0.048 - 9.599
  Salinity (PPS): 33.355 - 37.794
  Oxygen (ml/l): 3.230 - 4.705
  Phosphate (umol/l): 0.100 - 0.783
  Silicate (umol/l): 0.567 - 12.243

Graphical representation

Depth range (m): 1 - 168.5

Temperature range (°C): 22.185 - 28.783

Nitrate (umol/L): 0.048 - 9.599

Salinity (PPS): 33.355 - 37.794

Oxygen (ml/l): 3.230 - 4.705

Phosphate (umol/l): 0.100 - 0.783

Silicate (umol/l): 0.567 - 12.243
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 90m.
Recorded at 90 meters.

Habitat: reef-associated. Bluespotted stingray.  (Muller & Henle, 1841)  Attains 70 cm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits sandy areas among coral reefs. A solitary species found on sandy bottoms near rocky or coral reefs (Ref. 12951). Usually found in deeper water but moves onto the reef flat and into shallow lagoons at high tide (Ref. 12951). Occasionally covers itself with sand, leaving only its eyes and tail visible (Ref. 37816). Feeds on crabs and shrimps (Ref. 5578). A carnivore (Ref. 9137). Also Ref. 58534.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Exhibit ovoviparity (aplacental viviparity), with embryos feeding initially on yolk, then receiving additional nourishment from the mother by indirect absorption of uterine fluid enriched with mucus, fat or protein through specialised structures (Ref. 50449). Distinct pairing with embrace (Ref. 205). Litters size at birth 16 cm (Ref. 37816); Java form born at 11-16 cm WD, Bali form born at ~17 cm WD. Gives birth to litters of 1-2 pups; no reproductive synchronicity (Ref. 58048).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Neotrygon kuhlii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 80
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Neotrygon kuhlii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACTTAGTCTTTGGTGCATGAGCAGGGATAGTAGGCACTGGCCTCAGTTTACTTATCCGAACAGAATTAAGCCAACCAGGTGCTTTACTGGGTGATGATCAAATTTATAATGTTATCGTTACTGCCCACGCCTTCGTAATAATCTTCTTTATAGTAATGCCAATTATAATTGGTGGGTTTGGTAACTGACTAGTGCCCCTGATAATTGGGGCTCCGGACATAGCCTTTCCACGAATAAACAACATAAGTTTTTGACTTCTGCCCCCCTCATTCCTATTACTGCTAGCCTCAGCAGGAGTAGAAGCCGGAGCTGGAACAGGTTGAACAGTTTATCCCCCATTAGCCGGTAATCTAGCACATGCCGGAGCTTCTGTAGATCTTACAATCTTCTCTCTTCACCTAGCAGGTGTTTCCTCTATTCTGGCATCCATCAACTTTATCACAACAATTATTAATATAAAACCACCTGCAATCTCCCAGTATCAAACCCCATTATTCGTCTGATCTATTCTTGTTACAACTGTACTTCTCCTGCTATCCCTACCAGTCCTAGCAGCTGGCATTACTATACTCCTCACAGATCGAAATCTTAATACAACTTTCTTCGACCCAGCTGGAGGAGGGGATCCCATTCTTTACCAACACCTCNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Ocean Genome Legacy
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Fahmi & White, W.

Reviewer/s
Valenti, S.V. & Séret, B. (Shark Red List Authority)

Contributor/s

Justification
Bluespotted Stingray (Dasyatis kuhlii) is reported throughout a wide range from the western Indian Ocean to the eastern Pacific, but may be a complex of more than five species. Investigation is vital to resolve the taxonomic issues associated with this species complex and it is not possible to assess it beyond Data Deficient at present. The Bluespotted Stingray is taken as utilized bycatch of bottom trawl, trammel net and fish trap fisheries in many parts of its range. It is relatively common and possibly more resilient than some of the other larger ray species in parts of its known range, for example Indonesia. It is also exhibited in some public aquariums, but does not constitute a major species in aquarium trade. Further work is required to identify the species involved and make full assessments of their status.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Population size in Indonesia is still unknown. Market observations were conducted at several landing sites in Java and Kalimantan from 2005 to present, and showed that the species is quite common. They were recorded at almost all landing sites (fishing areas including the Java Sea, off southern Java (Indian Ocean), Sunda Strait, Karimata Strait, Makassar Strait, West Kalimantan, Natuna Islands) (Authors pers. obs. 2007).

Extensive surveys of various fish landings sites in eastern Indonesia, conducted between April 2001 and March 2006 recorded a total of 28,385 individual batoids, comprising 54 species belonging to 12 families. The Java form of D. kuhlii contributed 42.7% by number to the total number of batoids recorded and only 3.9% by biomass. The Bali form of D. kuhlii contributed 3.4% by number to the total number of batoids recorded and only 0.7 by biomass (White and Dharmadi 2007).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species is of commercial interest to fisheries throughout its range. It is also taken from the wild for use in aquariums (Compagno 1986).

In Indonesia, this species is caught as utilized bycatch in trawl, trammel net and Danish seine fisheries targeting mixed demersal fishes. It is commonly caught in large numbers by trawl and Danish seine boats operating in the Java Sea. This species is the second most important elasmobranch caught by the Danish seine fishery according to the total catch (biomass) and is the principle elasmobranch in terms of the total number of individuals (contributing ~ 700 kg/boat in average) (Fahmi pers. obs. 2007). According to anecdotal observations of artisanal fisheries catches in Java during August 2006?May 2007, the production of D. kuhlii increased (from 231 kg/boat in August 2006, to 724 kg/boat in May 2007). Total production of rays in Indonesian fishery statistics also showed an increasing trend (DGCF 2005).

It is utilised for its meat but of limited value due to its small size. The meat is often smoked and salted or dried for marketing locally. This is a relatively small ray and it may, possibly, be more resilient to depletion in fisheries than some of the other larger ray species in parts of its known range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
None currently in place. Research is required on taxonomy and population trends.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bluespotted stingray

Not to be confused with bluespotted ribbontail ray.

The bluespotted stingray (Neotrygon kuhlii) or Kuhl's stingray, is a species of stingray of the Dasyatidae family. It is light green with blue spots. Its disk width hovers around 42 centimeters (17 in). It is popular in aquaria but usually not distinguished from the bluespotted ribbontail ray. The ribbontail is rounder with brighter blue and more vivid spots, but the bluespotted stingray is larger.[1] The stingray's maximum age estimate is from one to eighteen years of age. The bluespotted stingray preys on many fish and small mollusks, but is also preyed on by the killer whale and hammer head shark.[2] The bluespotted stingray is also generally found in Indonesia to Japan, and south to Northern Australia. The bluespotted stingray is also targeted by many parasites such as tapeworms, flatworms, and flukes.

Taxonomy[edit]

The bluespotted stingray was discovered by Heinrich Kuhl in Java, Indonesia. The population of this species is greatly debatable due to the five different species of rays in Indonesia. Also, there are two different subgroups: the Java and Bali form.[3] The distinct difference between the two strains is their size, with the Bali being much larger than the Java.[4] On the familial level, the family Dasyatidae is made up of 9 genera and 70 species. The genus of Neotrygon are called maskrays, because of the color pattern around their eyes. The largest species of this family can grow up to 4 meters (13 ft).[5]

Description and behavior[edit]

The full body of a bluespotted stingray, showing the black and white striped tail.

The bluespotted stingray has a flat disc-like oval body in about 42 centimeters (17 in) in diameter and 70 centimeters (28 in) in length;[6] and their coloring is a dark green with blue spots with a light white underbelly also known as countershading. The bluespotted stingray's snout is very short and broadly angular along with its angular disc.[4] The rays' bright coloration serves as a warning for its venomous spines. The ray has a very long tail accommodating two venomous spines on the base of the tail. The tail is about twice as long as the body of the ray, and the barbs or spines are two different sizes, one being very large and the other a medium-sized barb. The bluespotted stingray has bright yellow eyes, and the eyes are positioned to allow them a wide angle of view. The spiracles, which allow them to breathe, are located directly behind the ray's eyes. The ray's gills and mouth are found on the underside of the body.[7] The ray normally lives alone or in small groups. One unique characteristic of the bluespotted stingray is that they rarely bury themselves in the sand only to hide from predators, unlike the majority of rays who bury themselves regularly.[7]

Shrimp, a bluespotted stingray's main food source.

Diet[edit]

This type of ray feeds on shrimp, small bony fish, mollusks, crabs and other worms. Due to the fact that this ray is a shallow bottom feeder, it has a small variety of marine life to prey on. The bluespotted stingray overpowers its prey by pinning them to the bottom of the seafloor with its fins. This ray does not have teeth, instead it has food-crushing plates on the sides of its mouth.[7]

Reproduction[edit]

The bluespotted stingray is ovoviviparous. The embryos are retained in eggs within the mother's body until they are ready to hatch. The embryos receive nourishment from the mothers' uterine fluid. Mothers give birth to up to seven pups per litter; these pups range from 6 inches (150 mm) to 13 inches (330 mm) long at birth.[8] The bluespotted stingray passes its offspring 32 sets of chromosomes.[4] The mother also has an annual reproductive cycle. Studies show that the mating season is in October and November and the ovulating season is in the Australian summer (December 1- February 28/29), which coincides with the embryonic development.[9]

Habitat[edit]

Bluespotted stingray range map.

The bluespotted stingray is commonly found in waters of depths about 0–90 meters (0–295 feet), being found near rocky coral reefs. This stingray is found in a tropical climate at 29°N- 31°S, and 20°E- 171°W.[4] At high tide the bluespotted stingray moves out into the shallow lagoons and reef flats.[3] It is found in northern Australia, Kenya, Madagascar, The island of Mauritius, Somalia, the east coast of South Africa, India. The bluespotted stingray is in almost the entire continental waters of Asia, including the Sea of Japan, Yellow Sea, East China Sea, Philippine Sea, Sulu Sea, Java Sea, Banda Sea, Celebes Sea, Andaman Sea, the Bay of Bengal and the Arabian Sea.[10]

The entire body of a blue-spotted stingray, with a thin, long, rod-like tail that distinguishes it from the blue-spotted ribbontail ray.

Threats and protected areas[edit]

In Queensland, Australia there are many areas for high protection of the bluespotted stingray, three being the Shoalwater, Corio Bay's Area Ramsar Site, and the Great Barrier Reef Marine Park. A major threat of the bluespotted stingray is the destruction of coral reefs mainly in the Western Pacific. The rays dwell in these reefs and the destruction and pollution from fertilizers and pesticides hurt them.[7] The ray is commonly caught in the Java Sea by fisherman trawling and by Danish seine boats in large quantities. The bluespotted stingray is the second most significant species out of the sharks, rays, and skate family to be fished, contributing to about 700 kilograms (1,500 lb) per boat in 2006-2007.[11]

Killer whales are the bluespotted stingray's main predator.

Predators[edit]

The hammerhead shark frequently preys on the bluespotted stingray... Also the killer whale is a threat, generally preying on juvenile rays. The rays coloration is a warning for the highly poisonous barbs, thus few animals attempt to overpower this ray.[8][12] The hammerhead shark uses its head to pin down the bluespotted stingray, while it is in shock and much weaker.[13] When a killer whale encounters a stingray they dig them up from the sand, then launch them into the air. Another strategy for subduing the ray involves the whale turning upside down, then biting the ray and flipping over, putting the stingray belly up and causing it to enter tonic immobility.[14]

Human interaction[edit]

Due to the unique characteristics of this ray it is very common to be found in pet trade, many people ignore the fact that in total maturity the size of the ray exceeds the capacity of many household aquariums.[7] The bluespotted stingray is generally fished for its meat, being either smoked and salted or dried for local markets.[11] It is caught in mass in bottom trawl, trammel, and fish traps. It is fished for its meat, but inexpensive due to small size.[4] The bluespotted stingray is very venomous and it has a barb approximately 12 inches (300 mm) long. The venom contains serotonin, 5' nucleotidase, and phosphodiesterase.[15]

The skin of the bluespotted stingray is often used for drums such as on the Arab and Turkish darbuka goblet drum and riq (def) tambourine.

Parasites[edit]

There are many parasites that inhibit the bluespotted stingray, this is a table of the common groups of the parasite, and the specific name of the parasite.[16]

Common ClassGroupParasite
TapewormsCestodes cephalobothriidaeCephalobothrium longisegmentum and Tylocephalum kuhli
TapewormsCestodes mixodigmatidaeTrygonicola macroporus
TapewormsCestodes onchobothriidaeAcanthobothrium bengalens, Acanthobothrium confusum, Acanthobothrium herdmani, and Acanthobothrium pingtanensis
TapewormsCestodes phyllobothriidaeEcheneibothrium trygonis, Phyllobothrium ptychocephalum, Rhinebothrium shipleyi, Scalithrium shipleyi, and Scalithrium trygonis
FlatwormsMonogeneans monocotylidaeDendromonocotyle kuhlii, Heterocotyle chinensis, Monocotyle kuhlii, and Monocotyle tritestis
FlukesTrematodes monocotylidaeProsorhynchus clavatum
FlukesTrematodes didymozoidaeDidymozoid larva
External video
Blue spotted stingray swimming YouTube
Hand feeding a blue spotted stingrayYouTube
How Whales Eat Sharks National Geographic

References[edit]

  1. ^ (Randall 2005, p. 18)
  2. ^ Jacobsen, I. P.; Bennett, M. B. (2010). "Age and growth of Neotrygon picta, Neotrygon annotata and Neotrygon kuhlii from north-east Australia, with notes on their reproductive biology". Journal of Fish Biology 77 (10): 2405–22. doi:10.1111/j.1095-8649.2010.02829.x. PMID 21155791. 
  3. ^ a b "Neotrygon kuhlii". International Union for Conservation of Nature and Natural Resources. 2007. Retrieved November 28, 2011. 
  4. ^ a b c d e "Neotrygon kuhlii- Blue-spotted stingray (Müller & Henle, 1841)". FishBase. 2010. Retrieved December 30, 2011. 
  5. ^ "Stingrays (Dasyatidae)". WILD Fact Sheets. February 11, 2008. Retrieved December 24, 2011. 
  6. ^ "Species Fact Sheet-- Rays". Shark Bay Ecosystem Research Project. Retrieved December 18, 2011. 
  7. ^ a b c d e "Blue Spot Stingray". John G. Shedd Aquarium. Retrieved December 18, 2011. 
  8. ^ a b Bester, Cathleen (November 11, 2011). "Blue Spotted Stingray". Ichthyology Department, Florida Museum of Natural History. 
  9. ^ Pierce, S. J.; Pardo, S. A.; Bennett, M. B. (2009). "Reproduction of the blue-spotted maskray Neotrygon kuhlii (Myliobatoidei: Dasyatidae) in south-east Queensland, Australia". Journal of Fish Biology 74 (6): 1291–308. doi:10.1111/j.1095-8649.2009.02202.x. PMID 20735632. 
  10. ^ "Neotrygon kuhlii (Müller & Henle, 1841)". World Register of Marine Species. 2009. 
  11. ^ a b "Neotrygon kuhlii (Bluespotted Stingray)". IUNC Red List. December 20, 2011. 
  12. ^ Pablico, Grace Tolentino (June 23, 2006). "Predator Summary — Neotrygon Kuhlii". FishBase. Retrieved December 27, 2011. 
  13. ^ "Hammerhead Shark". Aquatic Community. 2006. Retrieved December 31, 2011. 
  14. ^ How Whales Eat Sharks (television production). National Geographic TV. December 31, 2011. 
  15. ^ Auerbach, M.D., Paul S. (April 20, 2009). "The Tragic Death of Steve Irwin". Divers Alert Network. Retrieved December 31, 2011. 
  16. ^ "Host-parasite Database". Natural History Museum. November 13, 2011. 

Bibliography[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!