Overview

Comprehensive Description

Description

  Common names: sheephead (English), vieja (Espanol)
 
Semicossyphus pulcher (Ayres, 1854)


California sheephead



Body robust; head bluntly pointed, large adults  develop hump on forehead; 2 pairs of enlarged, curved canines at front of each jaw; rear of upper jaw with moderately enlarged canine on each side; dorsal fin with XII spines, 10 rays; anal rays III, 12; pectoral rays 17-19; lateral line complete, smoothly arched; scales relatively small, 52-57 on lateral line, those on head reaching only to rear of eyes.

IP:  brownish red to rose with white chin; TP:  blackish head and white chin, pink to dusky red midsection and blackish rear portion of body; juveniles  reddish orange with whitish midlateral stripe and large black spots on dorsal, anal and pelvic fins, and on caudal fin base.



Size: attains 91 cm.

Inhabits kelp beds and rocky shores.

Depth: 1-90 m.

Monterey, California to Baja and the western and central eastern Gulf of California.


   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Prefer rocky bottom, particularly in kelp beds. Often feed on hard-shelled organisms such as sea urchins, mollusks, lobsters and crabs. Spawning occur during the summer and the eggs are pelagic (Ref. 9311). Live to more than 50 years of age. Each individual functions first as a female but changes to a male at a length of about 30 cm. Pelagic spawners (Ref. 56049). Flesh is white, of good quality and marketed fresh (Ref. 9311). The large teeth can cause serious bite wounds.
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

California sheephead (Semicossyphus pulcher) are found in the Eastern Pacific Ocean along the California coast, from Monterey Bay to the Gulf of California (Cabo San Lucas). They are sometimes seen in the Gulf of California, Mexico, but are most abundant south of Point Conception, California.

Biogeographic Regions: nearctic (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Occurs in the eastern Pacific. Ranges from Point Conception in California, to Guadalupe Island (off northern central Baja California) and the Gulf of California, Mexico. However, the species is rare south of Punta Abreojos, apart from a small population at Isla Santa Margarita, near Bahia Magdalena (Cowen 1985). Water current anomalies may occasionally result in larvae of this species recruiting to reefs as far north as Monterey Bay (Cowen 1985).

Sheephead are found from Monterey Bay to the Gulf of California (Alonzo et al. 2004) but are uncommon north of Point Conception and are much less common in the Gulf of California than along the Pacific Coast (Miller and Lea 1972). In the Channel Islands, densities of 1,475–1,525 individuals of all sizes per hectare have been observed (Davis and Anderson 1989) while another survey, which covered much of the geographic range of the species (Point Conception to Isla Santa Margarita) (Cowen 1985) reported density range between 16–290 adult fish per hectare.

Extent of Occurrence and Area of Occupancy Notes:
Although this species is found from Point Conception (north of Santa Barbara) to Baja California and the Gulf of California, it is rare from Punta Abreojos south with the exception of Isla Santa Margarita (Cowen 1985). Suitable rocky reef area is assumed to extend 1 km offshore from land. The extent of occurrence is assumed to be the rocky reef area from Point Conception to Mazatlan at the mouth of the Gulf of California, and was calculated as 4,770–5,800 km² (5,300 +/- 10% to allow for inaccuracies in the calculations).

The area of occupancy is assumed to be the rocky reef area from Point Conception to Punta Abreojos (including Isla Santa Margarita) and was calculated as 1,692–2,070 km² (1,880 km² +/- 10% to allow for inaccuracies in the calculations).

Decline in extent of occurrence or area of occupancy has not been reported for the species. The California Sheephead inhabits rocky reefs, which are assumed not to fluctuate in size or quality, or be in decline. There is also no evidence of any habitat bottlenecks that could increase the vulnerability of this species although there is a suggestion that kelp beds could be important to part of their life history (Stephens 1992).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, East Pacific endemic, TEP non-endemic

Regional Endemism: All species, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California province, primarily, Continent + Island (s), Continent, Island (s)

Residency: Vagrant

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: Monterey Bay in California, USA to Guadalupe Island (off northern central Baja California) and Gulf of California.
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 90 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Juvenile California sheephead are bright reddish-orange with large blue spots on the dorsal, pelvic, and anal fins. They also have a white line running horizontally from the eye to the caudal fin. Male and female sheephead are sexually dimorphic. Males are black with and orange midsection and white chin. They have red eyes and a prominent, bulbous forehead. Females lack marked coloration but instead, are dull pink with white undersides. They are also smaller than males, lack the prominent forehead bulb present in males, are less robust overall. California sheephead have protruding teeth used to prey upon hard-shelled animals. Although average size is unknown, they can grow to be 16 kg in mass and 1 m long.

Range mass: 16 (high) kg.

Range length: 1 (high) m.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful; sexes shaped differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 91.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 910 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

91.0 cm TL (male/unsexed; (Ref. 2850)); max. published weight: 16.0 kg (Ref. 2850); max. reported age: 53 years (Ref. 56049)
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
  • Shanks, A.L. and G.L. Eckert 2005 Population persistence of California Current fishes and benthic crustaceans: a marine drift paradox. Ecol. Monogr. 75:505-524. (Ref. 56049)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

California sheephead inhabit rocky shoreline reefs, in and around kelp beds between 6 and 30 m in depth.

Range depth: 6 to 30 m.

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Inhabits rocky reefs, especially where there are kelp beds. It occurs from 0–55 m depth (Eschmeyer et al. 1983) although around Cabo San Lucas (southern tip of Baja California) it occurs only in deeper water, 60–100 m (Cowen 1985). The fish tend to stay in the same reef and do not move around a lot, as shown by tag-recapture research (DeMartini et al. 1994).

Maximum age is at least 50 years (Fitch and Lavenberg 1971); such old individuals are likely to be very rare, however. The oldest fish of 276 collected from 4 unexploited populations throughout the range of the California sheephead was 21 years (Cowen 1990). Furthermore, the oldest individual of 470 fish taken off California and Mexico in the early 1970s was 20 years (Warner 1975).

Growth parameters vary among populations and studies (Alonzo et al. 2004). The value of k ranged from 0.007 to 0.068, while estimated Lsub>inf ranged from 45.46 to 464.16 (cm fork length). The k = 0.068 and Linf = 83.86 cm (maximum length) were the best fit to the observed size and age data (Alonzo et al. 2004).

The age of sexual maturity and age of sex changeover (from female to male) shows great variation depending on location (Cowen 1990). For instance, at Santa Nicholas Island off California, the species becomes sexually mature (as females) at 5–6 years. Males did not predominate until ages 13–14. At the offshore Guadalupe Island, sexual maturity took place at 3–4 years with sexual transformation to males taking place at 5–6 years. Other locations in Mexico to the south of Guadalupe Island have populations that show ages of sexual maturity and changeover intermediate to the 2 aforementioned islands (Cowen 1990). Size of first sexual maturation varied from 12–18 cm SL in females and 18–28 cm SL in males, depending on location (Cowen 1990).

Size of 50% sexual maturation is approximately 20–30 cm, and sex change occurs roughly between 25 and 35 cm (Warner 1975, Cowen 1990).

In the area of Catalina Island, California, the Sheephead wrasse spawns from August to October, while sex change occurs during the winter months (Warner 1975, Cowen 1990). Individuals may spawn more than once a season. It has been estimated that females spawn approximately 86 times per year (about once every 1.3 days), batch fecundity of females is 5,755 eggs per spawning event, and there is no significant relationship between the number of eggs released per kilogram of body weight and total female body weight (average 15,000 eggs per kg) (DeMartini et al. 1994).

Generation time was calculated from samples of 4 relatively unexploited populations taken throughout the main area of distribution off California and Baja California (Cowen 1985). This species is protogynous, changing sex from female to male. Observed adult sex ratios in California Sheephead vary from 3:1 mature females to males to 0.8:1 (Cowen 1990). In unexploited populations, it seems likely that the females are limiting, although in exploited populations where males (as the larger animals) are targeted, males may ultimately become the limiting sex. The generation time for each location was calculated using the length frequency data for the females of the 4 populations (Figure 4 in Cowen 1990) and converting this to age frequency using the length-age relationship data (Figure 2 in Cowen 1990). Generation time, as the mean age of mature females varied from 4.1 to 8.5 years across the 4 populations, these are therefore set as the plausible limits of generation time. The mean of the 4 generation times calculated, 6.8, is assumed to be representative of the entire population and was, therefore, used as the point estimate.

The species is a generalist carnivore (Cowen 1983), feeding on mussels and red sea-urchins and may play an important role in regulating prey density (see citations in Alonzo et al. 2004).

Natural mortality is likely to be in the order of M=0.2 (Alonzo et al. 2004).

Data needed:
How effectively protected is this species in designated marine reserves since MPAs are probably an important management measure for this species?

It would be very useful to have recent fisheries independent data on California Sheephead stocks. At present, landings would have to decrease over a number of years with a constant or increasing fishing effort in order to recognise falling stocks. The obvious way to achieve fisheries independent data and quickly assess the state of fish stocks would be to repeat the underwater visual census work of Cowen (1985, 1990) and compare the data with his pre-intensive exploitation figures. In the meantime, changes in CPUE are likely to offer the best indications of changes in abundance.

There seems to have been little work on the ecology of this species. It would be important to know if populations of Sheephead were affected by changes in environment, or habitat, such as changes in the extent and quality of kelp beds.

Data from Mexico on landings and CPUE from 1976 onwards are needed.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 0 - 55 m (Ref. 9311), usually 3 - 30 m (Ref. 9311)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 2 - 15
  Temperature range (°C): 19.804 - 22.948
  Nitrate (umol/L): 0.860 - 2.687
  Salinity (PPS): 34.213 - 35.311
  Oxygen (ml/l): 4.912 - 5.078
  Phosphate (umol/l): 0.521 - 0.885
  Silicate (umol/l): 4.304 - 7.399

Graphical representation

Depth range (m): 2 - 15

Temperature range (°C): 19.804 - 22.948

Nitrate (umol/L): 0.860 - 2.687

Salinity (PPS): 34.213 - 35.311

Oxygen (ml/l): 4.912 - 5.078

Phosphate (umol/l): 0.521 - 0.885

Silicate (umol/l): 4.304 - 7.399
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 55m.
Recorded at 55 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Reef (rock &/or coral), Reef only, Rocks, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

California sheephead consumes benthic invertebrates including the purple sea urchins, Pacific rock crabs, acorn barnacles, mussels, clams, and bryozoans. They also eat snails, squids, common sand dollars, eccentric sand dollars, and sea cucumbers. Their large canine-like teeth are used to pry sessile invertebrates from rocks. A special pharyngeal plate in the throat crushes calcareous skeletal materials into small pieces so the prey's tissues can be separated and digested.

Animal Foods: fish; mollusks; aquatic or marine worms; aquatic crustaceans; echinoderms; other marine invertebrates

Primary Diet: carnivore (Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Prefers rocky bottom, particularly in kelp beds. Often feeds on hard-shelled organisms such as sea urchins, mollusks, lobsters and crabs. Spawning occurs during the summer and the eggs are pelagic (Ref. 9311). Lives to more than 50 years of age. Each individual functions first as a female but changes to a male at a length of about 30 cm.
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), mobile benthic gastropods/bivalves, sea-stars/cucumbers/urchins
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

California sheephead are carnivorous secondary and tertiary consumers, preying on various invertebrate species of kelp forest organisms. Their presence in kelp forests reduces the populations of California spiny lobsters and benthic grazing organisms such as purple sea urchins, red sea urchins, and gastropod mollusks. Senorita fish are known to clean parasites from the gills and skin of California sheephead, which are a known host of digenean flatworms.

Ecosystem Impact: keystone species

Mutualist Species:

Commensal/Parasitic Species:

  • McClanahan, T., B. George. 2008. Food Webs and the Dynamics of Marine Reefs. United States: Oxford University Press.
  • Nichols, K. 2009. "The effects of predators and habitat on sea urchin density and behavior in Southern California kelp forests" (On-line). Accessed March 28, 2011 at http://escholarship.org/uc/item/3zv9w2w2.
  • Norse, E., L. Crowder. 2005. Marine Conservation Biology: The Science of Maintaining the Sea's Biodiversity. Washington: Island Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In addition to being a popular game fish for anglers and spearfishers, California sheephead are commercially fished as well. Aside from human predation, California sheephead fall prey to various species of pinniped, including harbor seals and California sea lions and sea birds, such as double-crested cormorants

Known Predators:

  • California Department of Fish and Game, 2011. "California Department of Fish & Game, Marine Region, Marine Sportfish Identification: Other Fishes" (On-line). Accessed April 25, 2011 at http://www.dfg.ca.gov/marine/mspcont7.asp.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Pimelometopon pulchrum preys on:
Strongylocentrotus purpuratus
Strongylocentrotus franciscanus

Based on studies in:
USA: California, Southern California (Marine)

This list may not be complete but is based on published studies.
  • R. J. Rosenthal, W. D. Clarke, P. K. Dayton, Ecology and natural history of a stand of giant kelp, Macrocystis pyrifera, off Del Mar, California. Fish. Bull. (Dublin) 72(3):670-684, from p. 683 (1974).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

California sheephead communicate primarily through visual cues and displays. Males are black and orange, as opposed to the solid orange of females. Dominance hierarchies are formed in relation to size and age, and the presence of a male inhibits the sex change process in high-ranking females. Although many kelp forest fish are known to communicate with sound, there is no information on whether auditory communication is utilized by California sheephead. Like most bony fishes, they use the lateral line system to sense movement in the surrounding environment.

Communication Channels: visual

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

During spawning season, which lasts from August to October in coastal California, female California sheephead produce between 36,000 to 296,000 eggs. Eggs are fertilized while suspended in the water column and hatch into planktonic larvae. Females may spawn over 80 times annually. All larvae begin life as females, and those that survive to adulthood may change sex, developing into males if the dominant male leading the harem dies or leaves. Sex changeover in California sheephead typically occurs between 5 and 13 years of age, but can vary between locations. In areas of high food abundance, females change sex at a later age.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

A diandric species (Ref. 55367). Transforms to a male at length of about 30.1 cm TL and 7.9 years of age (Ref. 55367). Forms leks during breeding (Ref. 55367). Pelagic spawner (Ref. 56049).
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Although the average lifespan of California sheephead is unknown, they can live up to 53 years in the wild. However, due to commercial and recreational fishing, few animals attain this age. Aside from fishing pressure, natural causes of mortality are unknown.

Range lifespan

Status: wild:
53 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 53 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

California sheephead are polygamous, with dominant males maintaining a harem of females that is defended from other males.

Mating System: polygynous

California sheephead follow a consistent mating routine, which begins about an hour before sunset, as a group of females gather below the kelp canopy. Meanwhile, the largest and more dominant males define their territory by forcing smaller males outside from their courting zone, which is approximately 25 m in diameter. The male then selects a female and the mating process begins. The male circles above the female, keeping his pelvic fins down, and places his chin on the female’s head. After they circle and display several jerking motions, they swim to within 3 to 4 meters of the surface and spawn. Males repeat this process with each female, until all females in his territory have been mated or until sunset. Most individuals are sexually mature by 4 year of age.

Breeding season: California sheephead breed from late June until early September.

Range number of offspring: 36,000 to 296,000.

Average age at sexual or reproductive maturity (female): 4 years.

Average age at sexual or reproductive maturity (male): 4 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sequential hermaphrodite (Protogynous ); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

California sheephead are broadcast spawners. After eggs and sperm are released into the water column, fertilized planktonic eggs drift away with the current. Thus, parental care is nonexistent in this species.

Parental Investment: no parental involvement

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Semicossyphus pulcher

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CAAAGACATTGGCACCCTCTATCTAGTATTTGGTGCCTGAGCCGGAATAGTCGGTACCGCGCTAAGTTTACTTATCCGGGCAGAACTAAGCCAACCGGGCGCTCTCCTGGGAGACGACCAAATTTACAATGTAATCGTTACGGCGCATGCGTTCGTAATAATCTTCTTTATAGTAATACCAATCATGATCGGTGGCTTCGGAAACTGACTCATCCCCTTGATAATTGGGGCCCCCGACATAGCCTTTCCCCGAATAAATAATATGAGCTTCTGGCTTCTCCCCCCATCCTTCCTCCTCCTGTTAGCCTCTTCTGGGGTAGAAGCTGGAGCCGGGACCGGATGAACCGTCTACCCACCATTAGCGGGCAATCTAGCCCACGCAGGGGCCTCAGTCGATCTAACCATTTTCTCGCTCCATTTGGCAGGGATCTCCTCAATCTTAGGAGCAATCAATTTTATTACAACTATTATTAACATAAAACCACCAGCCATTTCTCAGTACCAAACTCCTCTGTTCGTCTGATCCGTTTTAATTACAGCCGTACTTCTCCTACTTTCACTCCCAGTCCTTGCCGCTGGTATTACAATGCTTCTAACCGACCGAAACTTAAATACCACCTTCTTTGACCCGGCAGGGGGAGGAGATCCAATTCTTTATCAACACCTATTCTGATTCTTCG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Semicossyphus pulcher

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 14 specimens with morphological vouchers housed at Queensland Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

California sheephead are classified as "vulnerable" on the IUCN's Red List of Threatened Species. In 2001, the California Department of Fish and Game (CDFG) developed regulations to help manage this species. In 2004, the CDFG reported the status of the fishery and identified the following needs: 1) increased need for biological data to contribute to the development of more appropriate growth rates and models, 2) behavioral studies of sex changing females to understand whether reducing fishery pressure or closing fishing seasons altogether would be more effective, and 3) more studies on exploitation rates of this species in the Gulf of California. The single major threat to their persistence is over-fishing. In 2001, size limits helped reduce commercial harvest, and bag limits helped reduce recreational harvest. Since 2002, further regulations have been placed on the California sheephead fishery, which essentially represents a seasonal closure to commercial fishing.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2bd

Version
3.1

Year Assessed
2006

Assessor/s
Cornish, A. & Dormeier, M. (Grouper & Wrasse Specialist Group)

Reviewer/s
Sadovy, Y. & Ng Wai Chuen (Grouper & Wrasse Red List Authority)

Contributor/s

Justification
Recent (last decade) increases in the level of exploitation, especially for the lucrative live fish trade, the catch of juveniles or small females, the life-history of the animal (i.e., large, long-lived, relatively slow to reach sexual maturation and sex-changing), and a limited geographic range are all factors that indicate that this species should be carefully monitored in the near future. This species was intensively fished in the past (at levels nearly as high as those in the late 1990s) in the 1920s but interest waned after a decade or so, which may have allowed stocks time to recover. Fishing pressure increased in the last decade.

Mainly juveniles are included in important commercial trap fishery, with juveniles and smaller adults dominating the hook and line and recreational fishery. Male numbers seem typically low which could result in sperm limitation for the species, with further male reduction, resulting in reduced reproductive output: males are readily targeted in the recreational spear fishery.

Commercial and recreational fishing pressure has increased (there is also an artisanal sector) and catches have declined over the last decade. Given the growing popularity of the live fish trade and its appeal for high retail prices, pressure may well grow in this commercial sector in particular, especially if prices increase as the species becomes less readily available.

Although variability in catches could be due to natural recruitment variation and also to changes in fishing effort; indications are that effort is likely to be increasing for commercial use and data from logbooks suggest that Catch Per Unit Effort (CPUE) has declined approximately 3-fold since the 1980s (Fig. 4.4.d in Alonzo et al. 2004). Recent declines in landings could be, at least in part, the consequence of management introduced in 2002. The effect of environmental conditions on recruitment is not known.

The natural history of this species, including its limited geographic range along inshore habitat, the likely increasing interest in the fishery and the currently unsustainable fishing levels (according to the models of Alonzo et al. 2004), together with the difficulties in enforcing existing regulations strongly suggest that this species will continue to decline if stronger protective action is not put into place.

In terms of the IUCN Red List Criteria, the extent of occurrence and area of occupancy are small enough to qualify this species as Endangered except that additional conditions related to these areas being in decline, population being severely fragmented or suffering extreme fluctuations are not met. However, the population has declined, judging primarily by a three-fold decline in CPUE. This could qualify S. pulcher as Endangered under reductions in population size >50% over the last three generations where the reduction and its causes have not ceased, and based on an index appropriate to the taxon (EN A2b). However, as such a large decline is not supported by landings data, and as increasingly stringent management has been enacted since 1999, S. pulcher is listed for now as Vulnerable based on a lesser reduction in population size of >30% (VU A2bd).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The recreational catch for 1999 was estimated at 77,226 fish with an estimated mean weight of 2.36 pounds (personal communication from the database of the National Marine Fisheries Service, Fisheries Statistics and Economics Division, Silver Spring, MD, 2001). If it is assumed that the average weight of commercially caught fish is the same, then 54,190 (129/767 pounds / 2.36) fish were caught in 1999 giving a total of 132,136 fish caught in commercial and recreational fisheries in 1999. Since 1999 both commercial and recreational catches have fluctuated although by 2003 the combined (total) catch had declined by 20%.

The maximum number of fishes in the population was calculated by the highest density of this species recorded for a site by underwater visual census (from Cowen 1985), multiplied by the area of occupancy. This seems reasonable as (1) densities were observed in the early 1980s prior to the recent increase in exploitation and (2) California Sheephead are reportedly rare outside the area of occupancy (see Extent of Occurrence and Area of Occupancy Notes above).

The highest density recorded was 8.5 mature individuals (calculated from Table 2 in Cowen 1990) per 250 sq. m. The upper estimate for the area of occupancy is 2,070 sq.km. This gives an upper population size of 70,380,000.

Landings data from Mexico appear to have become severely reduced between 1950 and 1976 – no further data are available. No CPUE data are available so it is not known whether effort changed over this time period.

Reduction Notes:
The commercial fishery for California Sheephead has shown distinct phases in fishing effort and only really became a significantly commercially targeted species in the 1980s/90s (Stephens 1992, Alonzo et al. 2004) as follows:

1960s: 2,150 - 12,708 kgs per year
1970s: 1,393 - 5,055 kgs per year
1980s: 4,130 - 110,547 kgs per year
1990s: 56,031 - 166,217 kgs per year
2000: 78,680 kgs per year
2001: 68,130 kgs per year
2002: 54,710 kgs per year
2003: 48,000 kgs per year

Sources: Leet et al. 1992; personal communication from the National Marine Fisheries Service, Fisheries Statistics and Economics Division, Silver Spring, MD, 2001; and Alonzo et al. 2004.

Recreational landings data, which can equal or exceed commercial landings (Stephens 1992), are only available in numbers of fish as follows:

Mean numbers of fish caught per year in recent decades were
1960s: 11,541 - 52,967 fish per year
1970s: 28,512 - 46,234
1980s: 21,072 - 68,972
1990s: 18,363 - 43,150

Below, recreational landings from Alonzo et al. 2004
1960s: 22,500 – 89,490 kgs per year
1970s: 49,940 – 78,600 kgs per year
1980s: 64,640 – 223,300 kgs per year
1990s: 45,500 – 121,120 kgs per year
2000: 100,090 kgs per year
2001: 58,850 kgs per year
2002: 60,260 kgs per year
2003: 68,510 kgs per year

Note that the above are landings data – there are no indications of fishing effort.

Population Reduction:
Although variability in catches could be due to natural recruitment variation and also to changes in fishing effort; indications are that effort is likely to be increasing for commercial use and data from logbooks suggest that CPUE has declined approximately 3-fold since the 1980s (Figure 4.4.d in Alonzo et al. 2004). Exploitation rate is estimated to have increased in recent history regardless of the estimate of natural mortality used (Alonzo et al. 2004).

Given that there is a fishery catching approximately 100,000 individuals of a large reef fish species that occupies a small geographic range, it seems very unlikely that the Sheephead population is expanding. At one extreme then, the population is assumed not to have changed in size (0% reduction). At the other extreme, it seems unlikely the population could have declined more than 50% overall without a marked decrease in landings in the US, something which is not apparent. The value of 50% is intuitive and is intended as an outside estimate.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The fishery for this species, which began in at least the late 1800s (for salted fish), peaked in 1928 with landings of 370,000 pounds. This may have been as the species was easily available close to port, and the species has maintained a presence in the California nearshore fishery (Alonzo et al. 2004). From the 1940s to 1980s there was little interest in the Sheephead and catches were usually under 10,000 pounds. Fish are taken by trap, set net, speargun and hook and line (Alonzo et al. 2004).

The fishery greatly increased from the late 1980s to the present. At least some of the new demand is for small and live fish, usually pre-reproductive females kept live in tanks in Asian seafood restaurants, prior to being eaten (Stephens 1992). While the Sheephead population was considered stable up until the early 1990s, the targetting of these juvenile animals gives some cause for concern (Stephens 1992) as some fish, mostly females, are being taken before they have had a chance to reproduce. Such fish will be up to 12–18 cm SL, depending on where they were caught (see size of sexual maturity in Cowen 1990), and are desired as they are small enough for the restaurant tanks. The live fish fishery resulted in considerably increased landing, reaching a peak of 166,364 kgs in 1997. During this time period, the prices (adjusted for the effects of inflation) increased from 0.10US$/lb in the 1940s to over $9.00/lb in the 1990s for live fish (Stephens 2001).

Recreational fish landings were higher than commercial landings in the 1980s and in 2002, the Sheephead was 13th in the recreational fishery in southern California. Large and old individuals are vulnerable to depletion by spearing since they are readily speared (CDFG 2003).

As an example of growth of the high value live fish (trap and hook and line) fishery for this species, between 1989 and 1992, increased from 2–27 boats landing over 23,636 kgs of live fish (Palmer-Zwahlen et al. 1993 cited in Alonzo et al. 2004). The Sheephead accounted for more than 88% of live fish landing in the developing live-fish fishery.

Recruitment in southern regions of the California Sheephead geographic range appears to be primarily from northern regions as this is the primary direction of current flow (Cowen 1985). If fishing were to reduce the numbers of breeding adults in the north (i.e., the US), this could result in decreased recruitment, and therefore numbers of mature adults, in the south (i.e., Mexico).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vulnerable (VU) (A2bd), IUCN Grouper and Wrasse Specialist Group
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Of the 19 nearshore species managed under the Nearshore Fishery Management Plan (NFMP), 16 (13 species of nearshore rockfish, California Scorpionfish, Cabezon, and Kelp Greenling) are designated as groundfish and fall under the management authority by the Pacific Fishery Management Council (PFMC). California Sheephead, Monkeyface Prickleback, and Rock Greenling do not have ‘groundfish’ designation, and thus are not managed by the PFMC (Alonzo et al. 2004). This lack of PFMC management led to State of California regulations for California Sheephead and few other species (CDFG 2002). Regulations for California Sheephead tend to fall under the general nearshore fishery regulations. The commercial fishery for both trap and hook and line gear is a restricted access fishery. Permits for the live-fish trap fishery began in 1996 in southern California and a statewide Nearshore Fishery Permit began in 1999. These permits are limited to individuals who have participated in the fishery the previous year as well as meeting historical catch criteria.

The Sheephead trap and hook and line fisheries reached optimal yield (OY) levels and closed early for all years beginning in 2001. According to the NFMP, "Optimum Yield" (OY) is defined in FGC section 97 (see Alonzo et al. 2004. p. 3) as the amount of fish taken in a fishery that does all of the following: (a) provides the greatest overall benefit to the people of California, particularly with respect to food production and recreational opportunities, and takes into account the protection of marine ecosystems, and (b) is the MSY of the fishery, reduced by relevant economic, social, or ecological factors, and (c) in the case of an overfished fishery, provides for rebuilding to a level consistent with producing MSY in the fishery (CDFG 2002). The 2002 OY was set to half that of total recent catches, and allocated almost 22,727 kgs more to the recreational fishery than the commercial fishery (Alonzo et al. 2004).

Size restrictions on Sheephead were fairly minimal before 1999 for both the recreational and commercial fisheries. In 1999, CDFG set the minimum catch size for the commercial fishery to 12 inches (total length) and followed with the same size limit for the recreational fishery in 2001. To further decrease commercial harvest, the minimum commercial harvest size was increased to 13 inches in 2001. Also in 2001, the 10 fish recreational bag limit was reduced to five (CDFG 2002).

In 2002, the Sheephead fishery was aligned with the nearshore rockfish fishery for both the commercial and recreational fisheries (CDFG 2002). Sheephead are not to be taken commercially north of Point Conception, Santa Barbara County during March and April, and south of Point Conception during January and February. This essentially represents a seasonal closure because the bulk of landings occur south of Point Conception (CDFG 2002). Other season and area closures affecting the Sheephead fishery result from management of the nearshore fishery. In 2001, taking Sheephead deeper than 20 fathoms in a Cowcod Conservation Area was banned.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known adverse effects of California sheephead on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

California sheephead are fished by anglers and spearfishers for food, and are caught live for the aquarium trade. The recreational and commercial catch of sheephead in 1999 was estimated at over 132,000 fish. In 2009, fishing vessels generated $333,801 in revenue from sheephead, much of that due to the lucrative live fish industry in Asian markets. California sheephead are economically valuable as keystone predators on purple sea urchins and red sea urchins, keeping them from overgrazing kelp forests. Thus, where they are present, sheephead contribute to the growth and biodiversity of kelp forests, and the corresponding increase in populations of other commercially-valuable fish species that are dependent on kelp habitat, such as kelp bass and white seabass.

Positive Impacts: food ; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: commercial; gamefish: yes; aquarium: commercial
  • Burgess, W.E., H.R. Axelrod and R.E. Hunziker III 1990 Dr. Burgess's atlas of marine aquarium fishes. T.F.H. Publications, Inc., Neptune City, New Jersey. 768 p.
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

California sheephead

The California sheephead, Semicossyphus pulcher, is a species of wrasse native to the eastern Pacific Ocean. Its range is from Monterey Bay, California, to the Gulf of California, Mexico.[2] This species can live for up to 20 years in favorable conditions and can reach a size of up to 3 ft and 30 lb. They are carnivorous, living in rocky reef and kelp bed habitats, feeding primarily on sea urchins, molluscs, and other crustaceans.

All California sheephead are born female and morph into their male form at various stages in their lifecycle, determined by environmental conditions and pressures. Because of this, they are considered to be protogynous hermaphrodites which have planktonic larvae. Their coral and kelp-heavy habitat provides protection from predators, which is important as this species is diurnal, foraging during the day and seeking shelter at night.

The California sheephead is considered vulnerable due to high fishing rates off of the coast of southern California. Since fisheries tend to remove the largest fish, they end up removing the males. This skews the male-to-female ratio and affects the fishes' lifecycle, which can negatively impact populations.

Description[edit]

Male and female sheepsheads have different color patterns and body shapes.[2] Males are larger, with black tail and head sections, wide, reddish orange midriffs, red eyes, and fleshy forehead bumps.[3] Female sheephead are dull pink with white undersides.[3] Both sexes have white chins and large, protruding canine teeth that can pry hard-shelled animals from rocks.[3] After powerful jaws and sharp teeth crush the prey, modified throat bones (a throat plate) grind the shells into small pieces.[3] Sheephead can reach a size of 91 cm and a weight of 16 kg.[2] All sheepheads are born as females and eventually change to males at roughly 45 cm.[2] The age of the transition depends on environmental factors such as food supply.[2] When supplied with a large amount of food, the California sheephead can live for up to 21 years. If food is scarce, they can live up to 9 years.[3]

Etymology[edit]

Semicossyphus is Greek; semi means half and kossyphos means a kind of fish. Pulcher is the Latin word for beautiful.[2] In French, the fish is called the labre Californien, and in Spanish it is called the vieja de California.[4]

Biology[edit]

The sheephead lives in kelp forests and rocky reefs, where it feeds on sea urchins, molluscs, lobsters, and crabs. Giving birth results in planktonic larva.[2]

Like many wrasse species, sheephead are protogynous. All are born female, and the largest individuals become male due to hormonal changes triggered by social cues. The two sexes have extremely different appearances, so this transition is among the most dramatic among the wrasses. Because only large individuals are male, setting minimum catch sizes has made populations mostly female, with a negative effect on population sizes.[5]

California sheephead in rocky reef habitat

Distribution and habitat[edit]

Home ranges in California sheephead vary greatly, and this variability can be attributed to differences in habitat shape (embayment versus contiguous coastline) and to natural habitat boundaries (deep, sandy expanses).[6] They are found in rocky-reef areas 54% of the time, and within those areas, a greater percentage of daytime is found in high relief areas.[6] Although their home ranges are thought of as particularly well defined, the size and fidelity may vary ontogenetically and seasonally and with habitat availability.[6] Sheephead home ranges are relatively small, and the fish have a very high site attachment.[6] They may select rocky areas with kelp most often due to the increased habitat complexity, which likely offers additional feeding opportunities and potential refuge from large predators.[6] Sheephead generally are considered mainly a rocky-reef and kelp-bed associated species, but they occasionally frequent sand habitats in foraging forays.[6]

Ecology[edit]

California sheephead are monandric protogynous hermaphrodites and are commercially and recreationally valuable labrids.[7] They are a prominent species occupying the southern California rocky reef and kelp bed fish assemblage.[6][8] Both the ecology and life history patterns of California sheephead have been shown to vary with local environmental conditions.[9]

Feeding[edit]

California sheephead are carnivorous, epibenthic reef fish, foraging mostly in the daytime in sand-rock reef habitats.[7] Their feeding territories are very productive and allow individuals to occupy small, permanent, economically defendable home ranges.[10] As a large temperate wrasse, they are predators of sea urchins and other benthic invertebrates and play a critical role in also regulating prey populations in kelp forests.[11] Since they feed heavily on urchins, they are consequently an important species for indirectly regulating kelp growth in southern California’s coastal waters.[7] However, they exhibit flexibility in prey selection if their main food source is not readily available at a particular time.[9] Populations with diets dominated by crabs and sea urchins, however, reach larger sizes and mature and change sex at larger sizes than populations that consume higher proportions of bivalves, barnacles, and bryozoans.[11] Since they forage in the daytime and are considered a diurnal species, they may rely on anatomical characteristics which allow them to feed in exposed locations in broad daylight while overcoming the defenses evolved by their prey.[12] They forage both in groups and alone, and larger fish tend to shift towards more heavily armored prey.[6][12]

Predation[edit]

As a reef fish, signals about the sheephead’s predation risk often comes from the presence of damage-released chemical cues produced by injured prey animals.[13] These clues are only released when the skin is ruptured, and act as a reliable indicator of the presence of an actively foraging predator.[13] Chemical cues may be released not only with injury, but also when pathogens or parasites penetrate the skin; therefore, the reliability of the chemical cues as indicators of predation risk is decreased.[13] When a sheephead is captured by a predator, and damage-released chemical cues are discharged, the information is available for both conspecifics and heterospecifics to use.[13]

California sheephead showing teeth in kelp bed habitat

Migration and territoriality[edit]

The behavior of sheephead is shaped by the daily cycle of light, twilight, and dark.[12] Diurnal fishes, like the sheephead, make a round trip between their refuges and foraging areas twice a day, and additional daily trips may be made by breeding fishes to spawning sites.[10] This elaborate diel timing of movements is driven by the need to forage or mate while minimizing predation.[10] Patterns in the movement of California sheephead are mediated by fish sex and size; for example, large males will exhibit higher site fidelity than females.[8][9] However, males also show wider ambits than females, and the size of their ambits changes seasonally.[9] During spawning season, males show a daily increase in their ambits during a period of potential spawning, and also make daily journeys offshore into deeper water.[9] Females (which would be expected to move more frequently among male territories) do not expand their ambits significantly during this same period.[9] Each of the movements offshore by males is followed by a return to nearshore habitat prior to twilight, suggesting the occupation of a spawning territory at that time.[9] At twilight, continuing to about 10 to 15 minutes after sunset, the degree of activity above the reef rapidly decreases and sheephead seek shelter for the night; this ‘quiet’ period is a time of major activity for larger reef predators.[12]

Male and female California sheephead have overlapping home ranges; although they are not usually considered a territorial species, male sheephead can exhibit territorial behavior.[6] Male sheephead are increasingly territorial throughout the day during periods of spawning activity.[6] Since spawning activity occurs around sunset, it may be that they only have differences in space use for short periods on various days during the spawning season, thus male territoriality only occurs in this same timespan.[6]

Breeding and lifecycle[edit]

California sheephead populations vary spacially in reproductive potential and reproductive capacity, and these differences are correlated with the natural sea surface temperature gradient.[14] Fish in cooler waters may require less energy for growth and may be able to convert more energy into reproduction than fish at warmer sites.[11][14] Population densities and sex ratios of hermaphroditic fishes are also intimately linked to ecological factors and human activities.[14] Spatial and temporal changes in fishing pressure, coupled with environmental changes across populations over time, tend to affect the reproductive potential of each population of California sheephead.[14] Spatially separate populations of California sheephead vary in their sex ratios (number of females to number of males), in size of individuals at sex change, and in the sex ratio threshold.[14] Sheephead are also haremic spawners, meaning each male defends a group of females with which he breeds.[8]

Sex change[edit]

California sheephead can transition from a reproductively functional female to a functional male during the course of a lifespan in response to social factors.[7] Protogynous sex change typically follows the size-advantage model, where gonadal transformation occurs once the reproductive potential of an individual would be greater as a male than as a female.[14] The transitional phase takes between two weeks and several months, and steroid hormone concentrations are thought to be related to sex change due to the total degradation of the ovaries and the appearance of testes.[7] The exact timing of the sexual morphogenesis is suppressed by aggressive interactions with dominant males and triggered by the removal of alpha males.[15] There is a period of reproductive inactivity during gonadal remodeling, and the sex change in this species is unidirectional.[7] In later stages of the transition, fish possibly are functionally male, but maintain an intersexual gonadal appearance.[7]

California sheephead at fish market

Human interaction[edit]

The fishery for this species, which began in at least the late 1800s (for salted fish), peaked in 1928 with landings of 370,000 pounds.[4] This may have been because the species was easily available close to port, and has maintained a presence in the California nearshore fishery.[4] From the 1940s to 1980s, little interest in the sheephead was shown, and catches were usually under 10,000 lb.[4] In the later 1980s, commercial fisheries began to supply live fish to Asian markets and restaurants.[3] The fisheries grew rapidly, with sheephead becoming a large share of the catches. Because restaurant aquariums are small, commercial fisheries seek small, juvenile sheephead, usually females before they have reproduced.[3]

California sheephead are fished by anglers and spearfishers for food, and are caught live for the aquarium trade.[16] The recreational and commercial catch of sheephead in 1999 was estimated at over 132,000 fish.[16] Mainly juveniles are included in important commercial trap fishery, with juveniles and smaller adults dominating the hook and line and recreational fishery.[4] In 2009, fishing vessels generated $333,801 in revenue from sheephead, much of that due to the lucrative live fish industry in Asian markets.[16] California sheephead are economically valuable as keystone predators on purple sea urchins and red sea urchins, keeping them from overgrazing kelp forests.[16] Thus, where they are present, sheephead contribute to the growth and biodiversity of kelp forests, and the corresponding increase in populations of other commercially-valuable fish species that are dependent on kelp habitat, such as kelp bass and white seabass.[16]

Conservation status[edit]

The California Sheephead is considered a vulnerable species because of its high fishing rates off of the coast of Southern California.[2] Usually most of the fish caught are the largest males, causing a shortage in males in the population and the subsequent morphogenesis of the largest females to males.[4] This, in turn, creates a deficiency in the number of eggs produced and weakens the population in a particular fishing area.[15] Male numbers seem typically low which also could result in sperm limitation for the species, with further male reduction, resulting in reduced reproductive output: males are readily targeted in the recreational spear fishery.[4] Commercial and recreational fishing pressure has increased (there is also an artisanal sector), and this has caused catches to decline over the last decade.[4] To control the catches of sheephead and prevent overfishing, the California Department of Fish and Game in 2001 established regulations that restrict the catch size of sheephead and the areas where these fish may be caught.[3]

Size restrictions on sheephead were fairly minimal before 1999 for both the recreational and commercial fisheries. But, in 1999, CDFG set the minimum catch size for the commercial fishery to 12 inches (total length) and followed with the same size limit for the recreational fishery in 2001.[4] To further decrease commercial harvest, the minimum commercial harvest size was increased to 13 in in 2001 and the 10-fish recreational bag limit was reduced to five.[4]

References[edit]

  1. ^ Cornish, A. & Dormeier, M. (Grouper & Wrasse Specialist Group) 2006. Semicossyphus pulcher. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 16 November 2013.
  2. ^ a b c d e f g h Froese, Rainer and Pauly, Daniel, eds. (2006). "Semicossyphus pulcher" in FishBase. February 2006 version.
  3. ^ a b c d e f g h "California sheephead". 
  4. ^ a b c d e f g h i j Cornish, A. "Semicossyphus pulcher". IUCN. 
  5. ^ Hamilton, Scott L.; J.E. Caselle, J.D. Standish, D.M. Schroeder, M.S. Love, J.A. Rosales-Casian, and O. Sosa-Nishizaki (2007). "Size-selective harvesting alters life histories of a temperate sex-changing fish". Ecological Applications 17 (8): 2268–80. doi:10.1890/06-1930.1. 
  6. ^ a b c d e f g h i j k Topping, D. T. (2005). "Home range and habitat utilization of adult California sheephead, Semicossyphus pulcher (Labridae), in a temperate no-take marine reserve". Marine Biology 147: 301–311. doi:10.1007/s00227-005-1573-1. 
  7. ^ a b c d e f g Sundberg, Michael (2009). "Gonadal Restructuring During Sex Transition in California Sheephead: a Reclassification Three Decades After Initial Studies". Bulletin, Southern California Academy of Sciences 108 (1): 16–28. doi:10.3160/0038-3872-108.1.16. 
  8. ^ a b c Froeschke, John (2006). "The Fish Assemblages Inside and Outside of a Temperate Marine Reserve in Southern California". Bulletin, Southern California Academy of Sciences 105 (3): 128–142. doi:10.3160/0038-3872(2006)105[128:tfaiao]2.0.co;2. 
  9. ^ a b c d e f g Lindholm, James (2010). "Gender-Mediated Patterns in the Movement of California Sheephead in the Northern Channel Islands (Eastern Pacific)". California Fish and Game 96 (1): 53–68. 
  10. ^ a b c Godin, Jean-Guy (1997). Behavioral Ecology of Teleost Fishes. Oxford: Oxford University Press. 
  11. ^ a b c Hamilton, Scott (September 2011). "Utilizing Spatial Demographic and Life History Variation to Optimize Sustainable Yield of a Temperate Sex-Changing Fish". PLoS ONE 6 (9). 
  12. ^ a b c d Pitcher, Tony (1986). The Behavior of Teleost Fishes. Baltimore: The Johns Hopkins University Press. 
  13. ^ a b c d Manassa, R.P. (2013). "Coral reef fish incorporate multiple sources of visual and chemical information to mediate predation risk". Animal Behaviour 86: 717–722. doi:10.1016/j.anbehav.2013.07.003. 
  14. ^ a b c d e f Loke, Kerri (2011). "Reproductive Potential of the Protogynous Teleost, California Sheephead (Semicossyphus pulcher) at Nine Populations across Southern California". California Sea Grant College Program. 
  15. ^ a b Hamilton, S. L., Caselle, J. E., Standish, J. D., Schroeder, D. M., Love, M. S., Rosales-Casian, J. A., & Sosa-Nishizaki, O. (2007). "Size-selective harvesting alters life histories of a temperate sex-changing fish". Ecological Applications 17 (8): 2268–2280. doi:10.1890/06-1930.1. 
  16. ^ a b c d e "Semicossyphus pulcher: California sheephead". 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!