Articles on this page are available in 2 other languages: Spanish (1), Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

The mosquitofish (Gambusia affinis) is a species of freshwater fish in the family Poeciliidae, native to the Mississippi River (USA) and its tributary waters from southern Indiana and Illinois to the Gulf Coast and parts of northeastern Mexico. It is commonly known by its generic name, gambusia, and sometimes called the western mosquitofish to distinguish it from the closely related eastern mosquitofish (G. holbrooki), which according to ITIS is actually a subspecies of G. affinis, rather than its own species; this has complicated classification of G. affinis). The name "mosquitofish" was given because the diet of this fish predominantly consists of large amounts of mosquito larvae (as well as other invertebrate larvae); an adult female can consume hundreds in a day. Hardy to a variety of temperatures, salinities and oxygen levels, mosquitofish have spread through many parts of the world in introductions attempting to reduce mosquito populations. Although this biocontrol did play a major role in containing malaria in South America, Russia and the Ukraine in the 1920s, they are now recognized the Global Invasive Species Database as one of the world’s 100 worst invasive species. This voracious, aggressive predator has extirpated and eliminated many native species, is extremely hard to eradicate, and is now a pest in fresh and brackish waters around the world. Mosquitofish are small; females reach an overall length of 7 centimeters and males at a length of 4 centimeters (1.6 in). Like all other New World members of this family, G. affinis gives birth to live young.

(Froese and Pauly 2011; ITIS 2011; IUCN/SSC Invasive Species Specialist Group 2010; Wikipedia 2012)

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Most abundant in lower reaches of streams (Ref. 44091). Adults inhabit standing to slow-flowing water; most common in vegetated ponds and lakes, backwaters and quiet pools of streams. Found frequently in brackish water (Ref. 5258). Pelagic and surface predatory fish (Ref. 94816). Feed on zooplankton, small insects and detritus (Ref. 5258, 10294). Used as live food for carnivorous aquarium fishes. Viviparous (Ref. 5258, 30578). Effective in mosquito control and widely introduced, but found to compete with indigenous fish and to upset the ecological balance (Ref. 6351).
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The mosquitofish, Gambusia affinis , is a small, robust-bellied fish. The relatively large head is flattened on the upper surface, and the small mouth is superior (upturned) and protrusible. The eyes are large relative to the body. Dorsal and caudal fins are rounded and no lateral line is visible (IGGS 2006).The body is usually greenish olive to brown above, grey-blue on the sides, and silvery-white below. The body has a characteristic diamond or net pattern on the body formed by dark pigment at the scale margins. Small black dots are also usually present on the body and tail. A small dark bar below the eye also aids in identification and a black peritoneum (abdominal cavity lining) can often be observed through the belly in living specimens. Melanistic (black or nearly black) individuals are common in some populations. The dorsal fin is single and has only soft rays. Individuals typically have 7-9 soft dorsal rays, 8-10 anal fins, and 29-32 lateral line scales (Hoese and Moore 1977, Robins et al 1986, IGGS 2006).The species is sexually dimorphic, with adult males being considerably smaller than females and also possessing a gonopodium-an elongated anal fin that functions as an intromittent organ for sperm transfer during mating. Mature females have a distinct gravid spot located on the posterior abdomen above the rear of the anal fin (Hoese and Moore 1977, GLAVCD undated).
  • Baber MJ and K. Babbitt. 2004. Influence of habitat complexity on predator-prey interactions between the fish (Gambusia holbrooki) and Tadpoles of Hyla squirella and Gastrophryne carolinensis. Copeia 2004:173-177.
  • Britton RH and ME. 1982. Size specific predation by herons and its effect on the sex-ratio of natural populations of the mosquito fish Gambusia affinis Baird and Girard. Oecologia 53:146-151.
  • Casterlin ME and WW Reynolds. 1977. Aspects of habitat selection in the mosquitofish Gambusia affinis . Hydrobiologia 55:125-127.
  • Cech JJ Jr., Massingill MJ, Vondracek B and AL. Linden. 1985. Respiratory metabolism of mosquitofish, Gambusia affinis : effects of temperature, dissolved oxygen, and sex difference. Environmental Biology of Fishes 13:297-307.
  • Collier A. 1936. The mechanism of internal fertilization in Gambusia. Copeia 1936:45-53.
  • FishBase. 2004. Species profile: Gambusia affinis Mosquito fish. Available online.
  • Greater Los Angeles County Vector Control District (GLAVCD). Undated. Mosquitofish fact sheet. Available online.
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Invasive Species Specialist Group (ISSG). 2006. Ecology of Gambusia affinis . Global Invasive Species database. Available online.
  • Krumholz LA. 1948. Reproduction in the western mosquitofish, Gambusia affinis affinis (Baird & Girard), and Its use in mosquito control. Ecological Monographs 18:1-43.
  • McDowall RM. 1990. New Zealand Freshwater Fishes, A Natural History and Guide. Heinemann Reed. 238 p.
  • McDowall, R. M. 2000. The Reed Field Guide to New Zealand Freshwater Fishes. Reed Publishing. 224 p.
  • Medlen AB. 1951. Preliminary observations on the effects of temperature and light upon Gambusia affinis . Copeia 1951:148-152.
  • Minckley WL., Meffe GK, and DL Soltz. 1991. Conservation and management of short-lived fishes: the cyprinodontoids. Pages 247-82 in: Minckley WL and JE Deacon (eds.). Battle Against Extinction: Native Fish Management in the American West. University of Arizona Press, Tucson, Arizona.
  • Moravec F, Huffman DJ, and DJ Swim. 1995. The first record of fish as paratenic hosts of Falcaustra spp. (Nematoda: Kathlaniidae). Journal of Parasitology 81:809-812.
  • Rajasekharan PT and BN Chowdaiah. 1972. Selective Feeding Behaviour of Gambusia affinis . Oecologia 11:79-81.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is native to most of south-central United States, north to Indiana and Illinois, west to Texas, south to southern Mexico, east to Mobile River system. Populations in the drainages of the Chattahoochee and Savannah rivers (Lydeard and Wooten 1991) possibly are native (Page and Burr 2011). See Walters and Freeman (2000) for information on the distribution of G. affinis and G. holbrooki in the Conasauga River system, where G. affinisi is widespread and native and G. holbrooki is apparently introduced and expanding its range. This fish is widely introduced in the western United States and throughout the world.

Lynch (1992) reported that five or six populations from Georgia, Illinois, Tennessee and Texas were used for most introductions nationwide and worldwide. Within the United States, sources from Illinois, Tennessee and Texas were used to establish mosquitofish in the western half of the country. Therefore, most if not all populations in the western United States are G. affinis.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) This species is native to most of south-central United States, north to Indiana and Illinois, west to Texas, south to southern Mexico, east to Mobile River system. Populations in the drainages of the Chattahoochee and Savannah rivers (Lydeard and Wooten 1991) possibly are native (Page and Burr 2011). See Walters and Freeman (2000) for information on the distribution of G. affinis and G. holbrooki in the Conasauga River system, where G. affinisi is widespread and native and G. holbrooki is apparently introduced and expanding its range. This fish is widely introduced in the western United States and throughout the world.

Lynch (1992) reported that five or six populations from Georgia, Illinois, Tennessee and Texas were used for most introductions nationwide and worldwide. Within the United States, sources from Illinois, Tennessee and Texas were used to establish mosquitofish in the western half of the country. Therefore, most if not all populations in the western United States are G. affinis.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North and Central America: Mississippi River basin from central Indiana and Illinois in USA south to Gulf of Mexico and Gulf Slope drainages west to Mexico. One of the species with the widest range of introductions which acquired for itself a near pan-global distribution. N.J. to s. Florida and around n. Gulf Coast of Texas.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North and Central America: Mississippi River basin from central Indiana and Illinois in USA south to Gulf of Mexico and Gulf Slope drainages west to Mexico. One of the species with the widest range of introductions which acquired for itself a near pan-global distribution (Ref. 1739). Several countries report adverse ecological impact after introduction.
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Gambusia affinis is native to fresh/low-salinity waters of the eastern and southeastern US and Gulf of Mexico, from New Jersey to central Mexico (Hoese and Moore 1977). They may be found in fresh water as far inland as Illinois (Ray et al. 1986).Mosquitofish now also occur throughout much of the world as a result of intentional and non-intentional introductions beginning approximately 100 years ago. Intentional introductions have largely been for purposes of mosquito control, although G. affinis is not considered to be any more effective against mosquitoes than most native mosquito-eating species (ISSG 2006). Gambusia affinis is a common inhabitant of lower salinity portions of the lagoon and associated upland freshwater systems. Salt marshes, mosquito impoundments, and mesohaline seagrass beds are among the habitats utilized by this species.
  • Baber MJ and K. Babbitt. 2004. Influence of habitat complexity on predator-prey interactions between the fish (Gambusia holbrooki) and Tadpoles of Hyla squirella and Gastrophryne carolinensis. Copeia 2004:173-177.
  • Britton RH and ME. 1982. Size specific predation by herons and its effect on the sex-ratio of natural populations of the mosquito fish Gambusia affinis Baird and Girard. Oecologia 53:146-151.
  • Casterlin ME and WW Reynolds. 1977. Aspects of habitat selection in the mosquitofish Gambusia affinis . Hydrobiologia 55:125-127.
  • Cech JJ Jr., Massingill MJ, Vondracek B and AL. Linden. 1985. Respiratory metabolism of mosquitofish, Gambusia affinis : effects of temperature, dissolved oxygen, and sex difference. Environmental Biology of Fishes 13:297-307.
  • Collier A. 1936. The mechanism of internal fertilization in Gambusia. Copeia 1936:45-53.
  • FishBase. 2004. Species profile: Gambusia affinis Mosquito fish. Available online.
  • Greater Los Angeles County Vector Control District (GLAVCD). Undated. Mosquitofish fact sheet. Available online.
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Invasive Species Specialist Group (ISSG). 2006. Ecology of Gambusia affinis . Global Invasive Species database. Available online.
  • Krumholz LA. 1948. Reproduction in the western mosquitofish, Gambusia affinis affinis (Baird & Girard), and Its use in mosquito control. Ecological Monographs 18:1-43.
  • McDowall RM. 1990. New Zealand Freshwater Fishes, A Natural History and Guide. Heinemann Reed. 238 p.
  • McDowall, R. M. 2000. The Reed Field Guide to New Zealand Freshwater Fishes. Reed Publishing. 224 p.
  • Medlen AB. 1951. Preliminary observations on the effects of temperature and light upon Gambusia affinis . Copeia 1951:148-152.
  • Minckley WL., Meffe GK, and DL Soltz. 1991. Conservation and management of short-lived fishes: the cyprinodontoids. Pages 247-82 in: Minckley WL and JE Deacon (eds.). Battle Against Extinction: Native Fish Management in the American West. University of Arizona Press, Tucson, Arizona.
  • Moravec F, Huffman DJ, and DJ Swim. 1995. The first record of fish as paratenic hosts of Falcaustra spp. (Nematoda: Kathlaniidae). Journal of Parasitology 81:809-812.
  • Rajasekharan PT and BN Chowdaiah. 1972. Selective Feeding Behaviour of Gambusia affinis . Oecologia 11:79-81.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

U.S.A. and Mexico, introduced widely elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 7 - 9; Analspines: 0; Analsoft rays: 9 - 10
  • Grant, E.M. 1965 Guide to fishes. 1st edition. Department of Harbours and Marine, Queensland. 280 p. Reprint of Fifth Edition, 1985. (Ref. 2158)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 6 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 40 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

4.0 cm TL (male/unsexed; (Ref. 30578)); 7 cm TL (female); max. reported age: 3 years (Ref. 796)
  • Beverton, R.J.H. and S.J. Holt 1959 A review of the lifespans and mortality rates of fish in nature, and their relation to growth and other physiological characteristics. p. 142-180. In G.E.W. Wolstenholme and M. O'Connor (eds.) CIBA Foundation colloquia on ageing: the lifespan of animals. volume 5. J & A Churchill Ltd, London. (Ref. 796)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Female mosquitofish reach a maximum total length of around 6-7 cm while males may reach around 4 cm (FishBase 2004, GLAVCD undated), although most individuals are somewhat smaller.The maximum age reported for the species is 3 years (FishBase 2004).
  • Baber MJ and K. Babbitt. 2004. Influence of habitat complexity on predator-prey interactions between the fish (Gambusia holbrooki) and Tadpoles of Hyla squirella and Gastrophryne carolinensis. Copeia 2004:173-177.
  • Britton RH and ME. 1982. Size specific predation by herons and its effect on the sex-ratio of natural populations of the mosquito fish Gambusia affinis Baird and Girard. Oecologia 53:146-151.
  • Casterlin ME and WW Reynolds. 1977. Aspects of habitat selection in the mosquitofish Gambusia affinis . Hydrobiologia 55:125-127.
  • Cech JJ Jr., Massingill MJ, Vondracek B and AL. Linden. 1985. Respiratory metabolism of mosquitofish, Gambusia affinis : effects of temperature, dissolved oxygen, and sex difference. Environmental Biology of Fishes 13:297-307.
  • Collier A. 1936. The mechanism of internal fertilization in Gambusia. Copeia 1936:45-53.
  • FishBase. 2004. Species profile: Gambusia affinis Mosquito fish. Available online.
  • Greater Los Angeles County Vector Control District (GLAVCD). Undated. Mosquitofish fact sheet. Available online.
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Invasive Species Specialist Group (ISSG). 2006. Ecology of Gambusia affinis . Global Invasive Species database. Available online.
  • Krumholz LA. 1948. Reproduction in the western mosquitofish, Gambusia affinis affinis (Baird & Girard), and Its use in mosquito control. Ecological Monographs 18:1-43.
  • McDowall RM. 1990. New Zealand Freshwater Fishes, A Natural History and Guide. Heinemann Reed. 238 p.
  • McDowall, R. M. 2000. The Reed Field Guide to New Zealand Freshwater Fishes. Reed Publishing. 224 p.
  • Medlen AB. 1951. Preliminary observations on the effects of temperature and light upon Gambusia affinis . Copeia 1951:148-152.
  • Minckley WL., Meffe GK, and DL Soltz. 1991. Conservation and management of short-lived fishes: the cyprinodontoids. Pages 247-82 in: Minckley WL and JE Deacon (eds.). Battle Against Extinction: Native Fish Management in the American West. University of Arizona Press, Tucson, Arizona.
  • Moravec F, Huffman DJ, and DJ Swim. 1995. The first record of fish as paratenic hosts of Falcaustra spp. (Nematoda: Kathlaniidae). Journal of Parasitology 81:809-812.
  • Rajasekharan PT and BN Chowdaiah. 1972. Selective Feeding Behaviour of Gambusia affinis . Oecologia 11:79-81.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

G. holbrooki usually has seven dorsal rays and a gonopodium with prominent teeth on ray three. G. affinis usually has six dorsal rays and lacks prominent teeth on gonopodial ray three. Both subspecies have a chromosome number of 2n = 48 but female G. affinis possess a large heteromorphic sex chromosome which is lacking in G. holbrooki (Black and Howell 1979).

In Arizona, G. affinis may be confused with Poeciliopsis occidentalis, the Sonoran topminnow. In topminnows the gonopodium is asymmetrical to the left, large hooks and serrae absent on gonopodial tip, and the gonopodium reaches beyond the snout when directed forward. The pelvic fins of males are unmodified and somewhat reduced. Many breeding males will be blackened. In G. affinis the gonopodium is symmetrical with large hooks and serrae on the tip. The pelvic fins of males are modified with a fleshy appendage on the distal third of the first, short, unbranched ray. Males are rarely blackened.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Origin of dorsal fin opposite 7th anal ray. Length of anal base much less than half distance from caudal. 8 horizontal scale rows between back and abdomen. Ventrals terminate immediately before anal fin. Pelvic fins reach ventrals.
  • Grant, E.M. 1965 Guide to fishes. 1st edition. Department of Harbours and Marine, Queensland. 280 p. Reprint of Fifth Edition, 1985. (Ref. 2158)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Zygonectes inurus
Catalog Number: USNM 29666
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Locality: Cache R., Ill., Illinois, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

As previously noted, Gambusia affinis and Gambusia holbrooki are sufficiently similar in appearance and behavior to cause considerable taxonomic difficulties, and these may or may not be distinct species. In south Florida, Gambusia affinis co-occurs with the congeneric mangrove gambusia, G. rhizophorae. The latter species is not known from as far north as the IRL however (Ray et al. 1986).The characteristic net-like scale pattern and the poster origin of the dorsal fin relative to the anal fin are typically sufficient to distinguish Gambusia from the co-occurring poeciliid, the sailfin molly, Poecilia latipinna (Hoese and Moore 1977).Poeciliid fishes can generally be differentiated from the potentially similar looking cyprinodontids (the killifishes) by the presence of either a gravid spot (mature females) or an intromittent organ (occurring on mature males) on the former.
  • Baber MJ and K. Babbitt. 2004. Influence of habitat complexity on predator-prey interactions between the fish (Gambusia holbrooki) and Tadpoles of Hyla squirella and Gastrophryne carolinensis. Copeia 2004:173-177.
  • Britton RH and ME. 1982. Size specific predation by herons and its effect on the sex-ratio of natural populations of the mosquito fish Gambusia affinis Baird and Girard. Oecologia 53:146-151.
  • Casterlin ME and WW Reynolds. 1977. Aspects of habitat selection in the mosquitofish Gambusia affinis . Hydrobiologia 55:125-127.
  • Cech JJ Jr., Massingill MJ, Vondracek B and AL. Linden. 1985. Respiratory metabolism of mosquitofish, Gambusia affinis : effects of temperature, dissolved oxygen, and sex difference. Environmental Biology of Fishes 13:297-307.
  • Collier A. 1936. The mechanism of internal fertilization in Gambusia. Copeia 1936:45-53.
  • FishBase. 2004. Species profile: Gambusia affinis Mosquito fish. Available online.
  • Greater Los Angeles County Vector Control District (GLAVCD). Undated. Mosquitofish fact sheet. Available online.
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Invasive Species Specialist Group (ISSG). 2006. Ecology of Gambusia affinis . Global Invasive Species database. Available online.
  • Krumholz LA. 1948. Reproduction in the western mosquitofish, Gambusia affinis affinis (Baird & Girard), and Its use in mosquito control. Ecological Monographs 18:1-43.
  • McDowall RM. 1990. New Zealand Freshwater Fishes, A Natural History and Guide. Heinemann Reed. 238 p.
  • McDowall, R. M. 2000. The Reed Field Guide to New Zealand Freshwater Fishes. Reed Publishing. 224 p.
  • Medlen AB. 1951. Preliminary observations on the effects of temperature and light upon Gambusia affinis . Copeia 1951:148-152.
  • Minckley WL., Meffe GK, and DL Soltz. 1991. Conservation and management of short-lived fishes: the cyprinodontoids. Pages 247-82 in: Minckley WL and JE Deacon (eds.). Battle Against Extinction: Native Fish Management in the American West. University of Arizona Press, Tucson, Arizona.
  • Moravec F, Huffman DJ, and DJ Swim. 1995. The first record of fish as paratenic hosts of Falcaustra spp. (Nematoda: Kathlaniidae). Journal of Parasitology 81:809-812.
  • Rajasekharan PT and BN Chowdaiah. 1972. Selective Feeding Behaviour of Gambusia affinis . Oecologia 11:79-81.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Habitat includes river channels, margins, backwaters; springs, marshes, and artificial habitats of all kinds (Minckley et al. 1991). Often this species occurs in shallow, often stagnant, ponds and the shallow edges of lakes and streams where predatory fishes are largely absent and temperatures are high. It is most abundant in shallow water with thick vegetation (Hubbs 1971). It also occurs in brackish sloughs and coastal saltwater habitats (Tabb and Manning 1961, Odum 1971). This fish is more tolerant of pollution than are most other fishes (Lewis 1970, Kushlan 1974). It tolerates dissolved oxygen levels as low as 0.18 mg/L (Ahuja 1964) but cannot tolerate extreme cold; temperature apparently limits the range northward (Hubbs 1971). However, some populations are known to overwinter under ice in Indiana and Illinois (Krumholz 1944).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Habitat includes river channels, margins, backwaters; springs, marshes, and artificial habitats of all kinds (Minckley et al. 1991). Often this species occurs in shallow, often stagnant, ponds and the shallow edges of lakes and streams where predatory fishes are largely absent and temperatures are high. It is most abundant in shallow water with thick vegetation (Hubbs 1971). It also occurs in brackish sloughs and coastal saltwater habitats (Tabb and Manning 1961, Odum 1971). This fish is more tolerant of pollution than are most other fishes (Lewis 1970, Kushlan 1974). It tolerates dissolved oxygen levels as low as 0.18 mg/L (Ahuja 1964) but cannot tolerate extreme cold; temperature apparently limits the range northward (Hubbs 1971). However, some populations are known to overwinter under ice in Indiana and Illinois (Krumholz 1944).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; potamodromous; freshwater; brackish; pH range: 6.0 - 8.0; dH range: 5 - 19
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 40 specimens in 2 taxa.

Environmental ranges
  Depth range (m): 0.05 - 2

Graphical representation

Depth range (m): 0.05 - 2
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits standing to slow-flowing water; most common in vegetated ponds and lakes, backwaters and quiet pools of streams (Ref. 5723). Most abundant in lower reaches of streams (Ref. 44091). Frequents brackish water. Feeds on insects, zooplankton and detritus. Used as live food for carnivorous aquarium fishes (Ref. 5723).
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Opportunistic omnivore; eats mainly small invertebrates, often taken near water surface. Also eats small fishes and, in the absence of abundant animal food, algae and diatoms (Moyle 1976).

Mosquitofish are principally carnivorous, and have strong, conical teeth and short guts (Meffe et al. 1983, Turner and Snelson 1984). They are reported to feed on rotifers, snails, spiders, insect larvae, crustaceans, algae, and fish fry, including their own progeny (Barnickol 1941, Minckley 1973, Meffe and Crump 1987). Cannibalism has been documented by several authors (Seale 1917, Krumholz 1948, Walters and Legner 1980, Harrington and Harrington 1982). Plant material is taken occasionally (Barnickol 1941) and may make up a significant portion of the diet during periods of scarcity of animal prey (Harrington and Harrington 1982). Grubb (1972) showed that anuran eggs from temporary ponds were preferentially selected over those breeding in permanent systems. Several workers have documented changes in the prey community after mosquitofish introduction (Hurlbert et al. 1972, Farley and Younce 1977, Hurlbert and Mulla 1981, Walters and Legner 1980).

Due to their name, these fishes are popularly believed to be "super" mosquito-larvae predators. Reddy and Shakuntala (1979), however, found that adult females grew poorly on a diet of mosquito larvae, but they grew quickly on tubifex worms. These results matched the outcome of preference tests, i.e. worms were chosen over mosquito larvae. Cech et al. (1980) found that juveniles grew more quickly when they were raised on brine shrimp nauplii than tubifex worms. Many biologists have concluded these fishes are no more effective in mosquito-larval control than various native fishes (Cross 1967). The effectiveness of predation on mosquito larvae decreases as water volume decreases (Reddy and Pandian 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mosquitofish feed primarily on zooplankton, small insects and insect larvae, and detrital material (ISSG 2006). As the common name suggests, they are voracious consumers of mosquito larvae. All sizes and ages of mosquitofish feed on mosquito larvae, and a large female mosquitofish can consume hundreds of larvae a day (GLAVCD undated). Rajasekharan and Chowdaiah (1972) demonstrated that G. affinis could discern between different species of simultaneously presented mosquito larvae and preferentially consumed certain species based on a number of factors facilitating prey capture, including size, vertical position in the water column, and the tendency of larvae to clump in groups.Baber and Babbitt (2004) indicate Gambusia () are capable of effectively consuming tadpoles of two Florida amphibians, significantly impacting prey density. In addition, G. affinis is capable of foraging effectively in densely vegetated areas that would likely provide cover from larger predatory fish.Mosquitofish, particularly where it occurs as a non-native, also prey heavily on the eggs and young of co-occurring fish species. Predators: Britton and Moser (1988) report that G. affinis represents a significant portion of the diets of four species of Camargue herons they studied. The authors also indicate that female fish are preferentially consumed over the smaller males, in apparent concordance with optimal foraging theory. Gambusia affinis has been discovered to be one of several primarily freshwater fishes that serve as intermediate hosts of nematodes of genus Falcaustra, adults of whom typically infest reptile or amphibian hosts (Moravec et al. 1995). Habitats: Gambusia affinis occurs in a variety of freshwater and in protected brackish environments. It preferentially occupies vegetated habitats, including salt marsh and seagrass beds (Ray 1986). It is benthic and non-migratory in habit and is most often encountered in standing or slow-flowing waters (FishBase 2004, IGGS 2006).Preference experiments by Casterlin and Reynolds (1977) revealed that mosquitofish selectively occupied areas with subsurface vegetation but avoided floating cover that restricted access to the water surface. Activity Time: Lined sole are typically active in the evening hours, spending much of the daytime hours buried in shallow sand.
  • Baber MJ and K. Babbitt. 2004. Influence of habitat complexity on predator-prey interactions between the fish (Gambusia holbrooki) and Tadpoles of Hyla squirella and Gastrophryne carolinensis. Copeia 2004:173-177.
  • Britton RH and ME. 1982. Size specific predation by herons and its effect on the sex-ratio of natural populations of the mosquito fish Gambusia affinis Baird and Girard. Oecologia 53:146-151.
  • Casterlin ME and WW Reynolds. 1977. Aspects of habitat selection in the mosquitofish Gambusia affinis . Hydrobiologia 55:125-127.
  • Cech JJ Jr., Massingill MJ, Vondracek B and AL. Linden. 1985. Respiratory metabolism of mosquitofish, Gambusia affinis : effects of temperature, dissolved oxygen, and sex difference. Environmental Biology of Fishes 13:297-307.
  • Collier A. 1936. The mechanism of internal fertilization in Gambusia. Copeia 1936:45-53.
  • FishBase. 2004. Species profile: Gambusia affinis Mosquito fish. Available online.
  • Greater Los Angeles County Vector Control District (GLAVCD). Undated. Mosquitofish fact sheet. Available online.
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Invasive Species Specialist Group (ISSG). 2006. Ecology of Gambusia affinis . Global Invasive Species database. Available online.
  • Krumholz LA. 1948. Reproduction in the western mosquitofish, Gambusia affinis affinis (Baird & Girard), and Its use in mosquito control. Ecological Monographs 18:1-43.
  • McDowall RM. 1990. New Zealand Freshwater Fishes, A Natural History and Guide. Heinemann Reed. 238 p.
  • McDowall, R. M. 2000. The Reed Field Guide to New Zealand Freshwater Fishes. Reed Publishing. 224 p.
  • Medlen AB. 1951. Preliminary observations on the effects of temperature and light upon Gambusia affinis . Copeia 1951:148-152.
  • Minckley WL., Meffe GK, and DL Soltz. 1991. Conservation and management of short-lived fishes: the cyprinodontoids. Pages 247-82 in: Minckley WL and JE Deacon (eds.). Battle Against Extinction: Native Fish Management in the American West. University of Arizona Press, Tucson, Arizona.
  • Moravec F, Huffman DJ, and DJ Swim. 1995. The first record of fish as paratenic hosts of Falcaustra spp. (Nematoda: Kathlaniidae). Journal of Parasitology 81:809-812.
  • Rajasekharan PT and BN Chowdaiah. 1972. Selective Feeding Behaviour of Gambusia affinis . Oecologia 11:79-81.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Rhabdochona Infestation 6. Parasitic infestations (protozoa, worms, etc.)
  • Moravec, F. 1998 Nematodes of freshwater fishes of the neotropical region. 464 p. Praha, Academy of Sciences of the Czech Republic. (Ref. 51153)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by a large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: "Possibly the single most abundant freshwater fish in the world" (Minckley et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

While population densities in some portions of the IRL may be limited by salinity, Minckley et al. (1991) suggest that Gambusia affinis may be "possibly the single most abundant freshwater fish in the world".
  • Baber MJ and K. Babbitt. 2004. Influence of habitat complexity on predator-prey interactions between the fish (Gambusia holbrooki) and Tadpoles of Hyla squirella and Gastrophryne carolinensis. Copeia 2004:173-177.
  • Britton RH and ME. 1982. Size specific predation by herons and its effect on the sex-ratio of natural populations of the mosquito fish Gambusia affinis Baird and Girard. Oecologia 53:146-151.
  • Casterlin ME and WW Reynolds. 1977. Aspects of habitat selection in the mosquitofish Gambusia affinis . Hydrobiologia 55:125-127.
  • Cech JJ Jr., Massingill MJ, Vondracek B and AL. Linden. 1985. Respiratory metabolism of mosquitofish, Gambusia affinis : effects of temperature, dissolved oxygen, and sex difference. Environmental Biology of Fishes 13:297-307.
  • Collier A. 1936. The mechanism of internal fertilization in Gambusia. Copeia 1936:45-53.
  • FishBase. 2004. Species profile: Gambusia affinis Mosquito fish. Available online.
  • Greater Los Angeles County Vector Control District (GLAVCD). Undated. Mosquitofish fact sheet. Available online.
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Invasive Species Specialist Group (ISSG). 2006. Ecology of Gambusia affinis . Global Invasive Species database. Available online.
  • Krumholz LA. 1948. Reproduction in the western mosquitofish, Gambusia affinis affinis (Baird & Girard), and Its use in mosquito control. Ecological Monographs 18:1-43.
  • McDowall RM. 1990. New Zealand Freshwater Fishes, A Natural History and Guide. Heinemann Reed. 238 p.
  • McDowall, R. M. 2000. The Reed Field Guide to New Zealand Freshwater Fishes. Reed Publishing. 224 p.
  • Medlen AB. 1951. Preliminary observations on the effects of temperature and light upon Gambusia affinis . Copeia 1951:148-152.
  • Minckley WL., Meffe GK, and DL Soltz. 1991. Conservation and management of short-lived fishes: the cyprinodontoids. Pages 247-82 in: Minckley WL and JE Deacon (eds.). Battle Against Extinction: Native Fish Management in the American West. University of Arizona Press, Tucson, Arizona.
  • Moravec F, Huffman DJ, and DJ Swim. 1995. The first record of fish as paratenic hosts of Falcaustra spp. (Nematoda: Kathlaniidae). Journal of Parasitology 81:809-812.
  • Rajasekharan PT and BN Chowdaiah. 1972. Selective Feeding Behaviour of Gambusia affinis . Oecologia 11:79-81.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

May experience severe winter mortality in some areas, but may quickly reestablish population.

Predators include water snakes (Nerodia) (Mushinsky and Hebrard 1977, Kofron 1978), water birds (Kushlan 1973), spiders (Suhr and Davis 1974), and fishes such as black basses and gars (Hunt 1953).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

The species is viviparous (Ref. 5258). Internal fertilization is possible because the anal fin of the male is modified into a copulatory organ. The females carries about 30 alevins and gestation lasts for a period of 24 days (Ref. 6348) to a month (Ref. 30578).
  • Seale, A. 1917 The mosquito fish, Gambusia affinis (Baird and Girard), in the Philippine Islands. Philipp. J. Sci. 12(3):177-189. (Ref. 6348)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 3 years Observations: The majority of animals die in the first year of life. Although age at sexual maturity has not been determined, it is likely less than three months. Reproductive senescence has been documented in these animals (Patnaik et al. 1994).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Fish born early in the spring may reproduce later in the summer and fall. Those born late in the reproductive season overwinter before reproducing (Krumholz 1948). In southcentral Texas, young may be collected from March to October with a peak in abundance in April (Davis 1978). In some constant temperature springs, these fish cease reproduction in winter (Brown and Fox 1966, Davis 1978). However, some populations from thermal habitats (such as cooling ponds and lakes) reproduce year-round (Ferens and Murphy 1974, Bennett and Goodyear 1978). At the Savannah River Power Plant site, South Carolina, fish reproduce throughout the winter although at much reduced brood sizes (Meffe, pers. comm., cited in Constantz 1989). These same workers found that the percentage of reproductively active females increased with increasing water temperature.

Mosquitofish have internal fertilization and are ovoviviparous (Sublette et al. 1990). Females can store sperm from one copulation and fertilize several broods sequentially (Krumholz 1948). After a gestational period of 21 to 28 days, the young are born alive at a size of approximately eight to nine mm total length (Krumholz 1948). Larger females produce more offspring (Krumholz 1948). Brood sizes of one to 315 young have been reported (Barney and Anson 1921, Moyle 1976). Females annually have four to five broods (Krumholz 1948). Sex ratios are 1:1 at birth, but in older cohorts, the number of males declines relative to the number of females (Krumholz 1948). Under optimal conditions females can become gravid at 6 weeks of age, produce 2-3 broods in first summer. Few individuals live more than 15 months (Moyle 1976).

Life history is flexible, varies with environmental conditions (Stearns 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

accomplished through the use of the male gonopodium. An early description of mating behavior is that of Collier (1936). The male faces forward and swings the gonopodium forward, initiating brief contact between the gonopodial tip and the oviductal opening and transferring sperm to the female.Viable sperm can be stored by females for several months, and the stored sperm in any female is likely derived from multiple matings with a variety of males (Medlen 1951).Male mosquitofish mature at approximately 1 month/21 mm SL, and females at 28 mm/6 weeks (McDowall 2000).
  • Baber MJ and K. Babbitt. 2004. Influence of habitat complexity on predator-prey interactions between the fish (Gambusia holbrooki) and Tadpoles of Hyla squirella and Gastrophryne carolinensis. Copeia 2004:173-177.
  • Britton RH and ME. 1982. Size specific predation by herons and its effect on the sex-ratio of natural populations of the mosquito fish Gambusia affinis Baird and Girard. Oecologia 53:146-151.
  • Casterlin ME and WW Reynolds. 1977. Aspects of habitat selection in the mosquitofish Gambusia affinis . Hydrobiologia 55:125-127.
  • Cech JJ Jr., Massingill MJ, Vondracek B and AL. Linden. 1985. Respiratory metabolism of mosquitofish, Gambusia affinis : effects of temperature, dissolved oxygen, and sex difference. Environmental Biology of Fishes 13:297-307.
  • Collier A. 1936. The mechanism of internal fertilization in Gambusia. Copeia 1936:45-53.
  • FishBase. 2004. Species profile: Gambusia affinis Mosquito fish. Available online.
  • Greater Los Angeles County Vector Control District (GLAVCD). Undated. Mosquitofish fact sheet. Available online.
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Invasive Species Specialist Group (ISSG). 2006. Ecology of Gambusia affinis . Global Invasive Species database. Available online.
  • Krumholz LA. 1948. Reproduction in the western mosquitofish, Gambusia affinis affinis (Baird & Girard), and Its use in mosquito control. Ecological Monographs 18:1-43.
  • McDowall RM. 1990. New Zealand Freshwater Fishes, A Natural History and Guide. Heinemann Reed. 238 p.
  • McDowall, R. M. 2000. The Reed Field Guide to New Zealand Freshwater Fishes. Reed Publishing. 224 p.
  • Medlen AB. 1951. Preliminary observations on the effects of temperature and light upon Gambusia affinis . Copeia 1951:148-152.
  • Minckley WL., Meffe GK, and DL Soltz. 1991. Conservation and management of short-lived fishes: the cyprinodontoids. Pages 247-82 in: Minckley WL and JE Deacon (eds.). Battle Against Extinction: Native Fish Management in the American West. University of Arizona Press, Tucson, Arizona.
  • Moravec F, Huffman DJ, and DJ Swim. 1995. The first record of fish as paratenic hosts of Falcaustra spp. (Nematoda: Kathlaniidae). Journal of Parasitology 81:809-812.
  • Rajasekharan PT and BN Chowdaiah. 1972. Selective Feeding Behaviour of Gambusia affinis . Oecologia 11:79-81.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Growth

Females typically brood around 60 young, but large individuals may carry 300 or more (McDowall 2000).The gestation period has been experimentally determined to average around 24 days, a timeframe that is in close agreement with field observations of pond-raised animals (Krumholz 1948). Most fry in the experimental investigation had absorbed the maternal yolk before being liberated, but some broods contained animals that had not completely absorbed the yolk sacs.
  • Baber MJ and K. Babbitt. 2004. Influence of habitat complexity on predator-prey interactions between the fish (Gambusia holbrooki) and Tadpoles of Hyla squirella and Gastrophryne carolinensis. Copeia 2004:173-177.
  • Britton RH and ME. 1982. Size specific predation by herons and its effect on the sex-ratio of natural populations of the mosquito fish Gambusia affinis Baird and Girard. Oecologia 53:146-151.
  • Casterlin ME and WW Reynolds. 1977. Aspects of habitat selection in the mosquitofish Gambusia affinis . Hydrobiologia 55:125-127.
  • Cech JJ Jr., Massingill MJ, Vondracek B and AL. Linden. 1985. Respiratory metabolism of mosquitofish, Gambusia affinis : effects of temperature, dissolved oxygen, and sex difference. Environmental Biology of Fishes 13:297-307.
  • Collier A. 1936. The mechanism of internal fertilization in Gambusia. Copeia 1936:45-53.
  • FishBase. 2004. Species profile: Gambusia affinis Mosquito fish. Available online.
  • Greater Los Angeles County Vector Control District (GLAVCD). Undated. Mosquitofish fact sheet. Available online.
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Invasive Species Specialist Group (ISSG). 2006. Ecology of Gambusia affinis . Global Invasive Species database. Available online.
  • Krumholz LA. 1948. Reproduction in the western mosquitofish, Gambusia affinis affinis (Baird & Girard), and Its use in mosquito control. Ecological Monographs 18:1-43.
  • McDowall RM. 1990. New Zealand Freshwater Fishes, A Natural History and Guide. Heinemann Reed. 238 p.
  • McDowall, R. M. 2000. The Reed Field Guide to New Zealand Freshwater Fishes. Reed Publishing. 224 p.
  • Medlen AB. 1951. Preliminary observations on the effects of temperature and light upon Gambusia affinis . Copeia 1951:148-152.
  • Minckley WL., Meffe GK, and DL Soltz. 1991. Conservation and management of short-lived fishes: the cyprinodontoids. Pages 247-82 in: Minckley WL and JE Deacon (eds.). Battle Against Extinction: Native Fish Management in the American West. University of Arizona Press, Tucson, Arizona.
  • Moravec F, Huffman DJ, and DJ Swim. 1995. The first record of fish as paratenic hosts of Falcaustra spp. (Nematoda: Kathlaniidae). Journal of Parasitology 81:809-812.
  • Rajasekharan PT and BN Chowdaiah. 1972. Selective Feeding Behaviour of Gambusia affinis . Oecologia 11:79-81.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gambusia affinis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAACCACACGTTGACTCTTTTCAACCAATCATAAAGATATCGGCACCCTCTACCTACTATTTGGTGCCTGAGCTGGCATAGTTGGAACAGCTCTGAGCCTACTCATCCGGGCCGAACTCAGTCAGCCAGGCACACTTCTTGGAGATGACCAGATCTACAATGTAATCGTTACAGCTCATGCTTTTGTAATAATCTTTTTTATAGTTATACCCATCATAATTGGAGGATTTGGTAACTGACTAGTCCCCCTAATAATTGGTGCCCCCGACATGGCCTTTCCACGAATAAACAACATAAGCTTTTGATTACTTCCCCCCTCATTTCTCCTCCTCCTTGCATCTTCTGGGGTTGAAGCAGGGGCAGGAACAGGCTGAACTGTCTACCCCCCTCTCGCAGGTAACCTAGCCCATGCCGGACCTTCTGTAGACTTAACCATCTTTTCCCTTCACCTAGCGGGCATCTCCTCTATTCTGGGAGCTATTAATTTTATTACCACCATTATTAATATAAAACCTCCCGCAGCCTCCCAGTACCAAACACCATTGTTTGTGTGAGCAGTCCTAATTACAGCTGTCCTCCTTCTTCTTTCCCTTCCAGTTCTTGCCGCAGGCATTACAATACTTCTTACAGATCGAAACCTAAACACCACTTTCTTTGATCCGGCGGGGGGCGGAGACCCAATCCTCTATCAACACCTGTTCTGGTTTTTCGGGCATCCGGAAGTTTATATTCTTATCTTACCAGGCTTCGGAATAATCTCACACATTGTGGCTTACTATGCCGGAAAGAAAGAACCTTTTGGCTACATGGGCATAGTGTGAGCTATAATAGCCATCGGGCTGCTAGGCTTCATTGTTTGAGCCCACCACATATTCACAGTTGGGATAGATGTTGACACTCGTGCCTACTTTACATCAGCAACAATAATTATTGCCATCCCCACAGGGGTAAAAGTCTTCAGTTGACTAGCCACGCTACATGGAGGAGCCCTAAAGTGGGATACGCCCCTTCTTTGAGCTCTCGGCTTTATTTTCCTCTTCACAGTAGGAGGCCTTACAGGAATTATTCTAGCAAATTCATCCCTAGATATTGTACTTCATGACACCTATTACGTAGTAGCCCATTTCCACTACGTCCTCTCAATAGGAGCTGTCTTTGCCATTTTCGCAGGGTTTGTTCACTGGTTCCCACTATTCTCGGGCTATACACTTCACAGTACTTGAACAAAAATCCACTTCGGAATCATGTTTGTTGGTGTTAACCTAACCTTTTTCCCTCAACATTTCTTAGGTTTAGCAGGCATGCCCCGTCGGTACTCAGACTACCCAGACGCATACACACTATGAAACACAGTGTCCTCAATCGGCTCACTAATTTCTCTTACAGCAGTAGTTCTCTTCCTATTTATTCTCTGAGAAGCCTTTACAGCAAAACGAGAAGTGCTCTCAACCCACCTTATCACAACGAACGTCGAATGACTTCACGGCTGCCCACCCCCTTACCACACATTTGAAGAACCCGCGTTTGTACAATTACAACAGACCTCCAAATAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gambusia affinis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 34
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, apparently stable trend, and lack of major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of occurrences (subpopulations).

"Possibly the single most abundant freshwater fish in the world" (Minckley et al. 1991).

Trend over the past 10 years or three generations is uncertain but likely relatively stable.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Trend over the past 10 years or three generations is uncertain but likely relatively stable.

Global Long Term Trend: Increase of >25%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: No major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Restoration Potential: Not applicable.

Preserve Selection and Design Considerations: Lands do not need to be protected to provide adequate habitat within the native range.

Management Requirements: It is unclear whether management activities can control this fish. Eradication efforts have often been temporarily successful, but either not all individuals were killed or reintroductions were made. Certainly, eradication efforts must be followed with intensive monitoring. Preventative measures, such as barrier construction to obstruct the paths into uncolonized tributaries, should be taken when feasible. Transport and introduction of non-native fishes should be curtailed. Natural flooding regimes in western streams could aid in keeping populations in check. Meffe (1984, 1985) showed that flooding removes proportionally more mosquitofish than native topminnows.

Regulations should be drafted and/or enforced that discourage transport and stocking of non-native fishes into uncolonized habitats. An education program targeted at fishers relating the damage non-native fishes do to the environment should be implemented. An education program targeted at state and federal agencies should be implemented explaining the detrimental impact of stocking mosquitofish for mosquito larvae control. Natural barriers can be enhanced, or new barriers built to prevent the invasion of non-native fishes. Barrier design should not significantly alter stream flow and the potential impact on natural upstream and downstream movements of native fishes should be assessed. Barrier design must be approved by appropriate agencies and the appropriate Desert Fishes Recovery Teams.

Management Research Needs: Because this is a wide ranging eastern species, much of the biology is known in the native habitat. The following specific topics are research areas that should be addressed relative to locations where introductions have been made: (1) rate of colonization in stream reaches after flooding events or after new introductions, (2) competition for food with native species, comparing diets of all life stages, (3) reproductive potential in introduced locations, emphasizing comparisons with native species, (4) aggression and predation directed towards native species in field studies, and (5) an evaluation of past eradication efforts, and (6) an analysis of sites where mosquitofish and native species have coexisted for several years (e.g. Black Draw, San Bernardino National Wildlife Refuge), and comparison to sites where mosquitofish and native species do not coexist.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial
  • Titcomb, M. 1972 Native use of fish in Hawaii. The University Press of Hawaii, Honolulu, Hawaii, USA. 175 p. (Ref. 7364)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic/Ecological Importance: Gambusia affinis is among the most widely introduced fish species worldwide, and a number of countries have reported negative environmental consequences in the wake of mosquitofish introduction (Fishbase 2004).Although effective as a mosquito control agent and widely introduced for this purpose, mosquitofish have been found to compete with or displace indigenous fish and to otherwise disrupt habitats. For example, McDowall (1990) reports that selective predation by mosquitofish can alter zooplankton, insect and crustacean communities.G. affinis has been nominated as among the 100 "World's Worst" invaders by the Invasive Species Specialist Group (ISSG 2006).
  • Baber MJ and K. Babbitt. 2004. Influence of habitat complexity on predator-prey interactions between the fish (Gambusia holbrooki) and Tadpoles of Hyla squirella and Gastrophryne carolinensis. Copeia 2004:173-177.
  • Britton RH and ME. 1982. Size specific predation by herons and its effect on the sex-ratio of natural populations of the mosquito fish Gambusia affinis Baird and Girard. Oecologia 53:146-151.
  • Casterlin ME and WW Reynolds. 1977. Aspects of habitat selection in the mosquitofish Gambusia affinis . Hydrobiologia 55:125-127.
  • Cech JJ Jr., Massingill MJ, Vondracek B and AL. Linden. 1985. Respiratory metabolism of mosquitofish, Gambusia affinis : effects of temperature, dissolved oxygen, and sex difference. Environmental Biology of Fishes 13:297-307.
  • Collier A. 1936. The mechanism of internal fertilization in Gambusia. Copeia 1936:45-53.
  • FishBase. 2004. Species profile: Gambusia affinis Mosquito fish. Available online.
  • Greater Los Angeles County Vector Control District (GLAVCD). Undated. Mosquitofish fact sheet. Available online.
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Invasive Species Specialist Group (ISSG). 2006. Ecology of Gambusia affinis . Global Invasive Species database. Available online.
  • Krumholz LA. 1948. Reproduction in the western mosquitofish, Gambusia affinis affinis (Baird & Girard), and Its use in mosquito control. Ecological Monographs 18:1-43.
  • McDowall RM. 1990. New Zealand Freshwater Fishes, A Natural History and Guide. Heinemann Reed. 238 p.
  • McDowall, R. M. 2000. The Reed Field Guide to New Zealand Freshwater Fishes. Reed Publishing. 224 p.
  • Medlen AB. 1951. Preliminary observations on the effects of temperature and light upon Gambusia affinis . Copeia 1951:148-152.
  • Minckley WL., Meffe GK, and DL Soltz. 1991. Conservation and management of short-lived fishes: the cyprinodontoids. Pages 247-82 in: Minckley WL and JE Deacon (eds.). Battle Against Extinction: Native Fish Management in the American West. University of Arizona Press, Tucson, Arizona.
  • Moravec F, Huffman DJ, and DJ Swim. 1995. The first record of fish as paratenic hosts of Falcaustra spp. (Nematoda: Kathlaniidae). Journal of Parasitology 81:809-812.
  • Rajasekharan PT and BN Chowdaiah. 1972. Selective Feeding Behaviour of Gambusia affinis . Oecologia 11:79-81.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Stewardship Overview: The spread of mosquitofish outside its native range should be monitored and necessary steps taken to: (1) understand the competitive edge it has over native species, (2) limit its introduction or invasion into new locations, and (3) evaluate the possible benefit of eradication efforts in locations that can be rehabilitated for native fishes.

Species Impact: Outside their native range, mosquitofish play a role in decreasing populations of native fishes (Miller 1961, Myers 1965, Minckley and Deacon 1968). Due to the number of introductions and corresponding decreases in native fish populations, there can be no doubt of the destructive nature of such introductions. Myers (1965) wrote that almost everywhere introductions have been made, mosquitofish have gradually eliminated or reduced populations of small native fishes. For example, mosquitofish have been instrumental in eliminating native populations of Poeciliopsis occidentalis in the southwestern U.S. (Sublette et al. 1990); P. occidentalis may be effectively eliminated in 1-3 years (Meffe 1984). Evermann and Clark (1931) reported that mosquitofish in the Salton Sea, California, drove out Cyprinodon macularius less than 10 years after introduction to the state. The mechanism for many of these reductions is believed to be predation (Meffe 1985, Courtenay and Meffe 1989). Myers (1965) reported that mosquitofish have even reduced largemouth bass (Micropterus salmoides) and carp (Cyprinus carpio) populations due to predation on larvae. Another problem is caused when mosquitofish hybridize with other Gambusia species (Yardley and Hubbs 1976, Rutherford 1980). Intergradation then corrupts the genome of the native species.

Introduced mosquitofish also prey heavily on amphibian larvae (Goodsell and Kats 1999) and potentially negatively impact salamander and frog populations (Lawler et al. 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Mosquitofish

Not to be confused with eastern mosquitofish or Heterandria formosa.

The western mosquitofish (Gambusia affinis) is a species of freshwater fish, also known commonly, if ambiguously, as simply mosquitofish or by its generic name, Gambusia, or by the common name gambezi. There is also an eastern mosquitofish (G. holbrooki).[2]

Mosquitofish are small in comparison to other fish, with females reaching an overall length of 7 cm (2.8 in) and males at a length of 4 cm (1.6 in). The female can be distinguished from the male by her larger size and a gravid spot at the posterior of her abdomen.

The name "mosquitofish" was given because the diet of this fish sometimes consists of large numbers of mosquito larvae, relative to body size.[3] Gambusia typically eat zooplankton, beetles, mayflies, caddisflies, mites, and other invertebrates; mosquito larvae make up only a small portion of their diet.[4]

Mosquitofish were introduced directly into ecosystems in many parts of the world as a biocontrol to lower mosquito populations which in turn negatively affected many other species in each distinct bioregion. Mosquitofish in Australia are classified as a noxious pest and may have exacerbated the mosquito problem in many areas by outcompeting native invertebrate predators of mosquito larvae.

Several counties in California distribute mosquitofish at no charge to residents with manmade fish ponds and pools as part of their mosquito abatement programs.[5][6][7] The fish are made available to residents only and are to be used only on their own property, not introduced into natural habitat. On 24 February 2014, Chennai Corporation introduced western mosquitofish in 660 ponds to control the mosquito population in freshwater bodies.[8]

Fertilization is internal; the male secretes milt into the genital aperture of the female through his gonopodium.[3][9] Within 16 to 28 days after mating, the female gives birth to about 60 young.[3][10] The males reach sexual maturity within 43 to 62 days. The females, if born early in the reproductive season, reach sexual maturity within 21 to 28 days; females born later in the season reach sexual maturity in six to seven months.[1]

Description[edit]

Mosquitofish are small and dull grey, with a large abdomen, and have rounded dorsal and caudal fins and an upturned mouth towards the surface.[3] Sexual dimorphism is pronounced; mature females reach a maximum overall length of 7 cm (2.8 in), while males reach only 4 cm (1.6 in). Sexual dimorphism is also seen in the physiological structures of the body. The anal fins on adult females resemble the dorsal fins, while the anal fins of adult males are pointed. This pointed fin, referred to as a gonopodium, is used to deposit milt inside the female. Adult female mosquitofish can be identified by a gravid spot they possess on the posterior of their abdomens. Other species considered similar to G. affinis include Poecilia latipinna, Poecilia reticulata, and Xiphophorus maculatus; it is commonly misidentified as the eastern mosquitofish.[3][11]

Naming and taxonomy[edit]

The mosquitofish is a member of the family Poeciliidae of order Cyprinodontiformes. The genus name Gambusia is derived from the Cuban Spanish term gambusino, meaning "useless".[2] The common name, mosquitofish, is derived from their diet, which, under some circumstances, consists of large numbers of mosquito larvae. Classification of the western mosquitofish has been difficult due to their similarity to the eastern mosquitofish, and according to ITIS (Integrated Taxonomic Information System), G. holbrooki (eastern mosquitofish) is an invalid taxonomic name and is rather a subspecies of G. affinis.[3][12]

Diet[edit]

Mosquito larvae.

Based on diet, mosquitofish are classified as larvivorous fish.[13] Their diet consists of zooplankton, small insects and insect larvae, and detritus material. Mosquitofish feed on mosquito larvae at all stages of life. Adult females can consume hundreds of mosquito larvae in one day.[3] Maximum consumption rate in a day by one mosquitofish has been observed to be from 42%–167% of its own body weight.[14] They can suffer mortalities if fed only on mosquito larvae, and survivors show poor growth and maturation.[15] Mosquitofish have also shown cannibalistic behavior in laboratory experiments; however, whether these traits are hereditary is unknown.[16]

Habitat[edit]

The native range of the mosquitofish is from southern parts of Illinois and Indiana, throughout the Mississippi River and its tributary waters, to as far south as the Gulf Coast in the northeastern parts of Mexico.[17] They are found most abundantly in shallow water protected from larger fish.[9] Mosquitofish can survive relatively inhospitable environments, and are resilient to low oxygen concentrations, high salt concentrations (up to twice that of sea water), and temperatures up to 42 °C (108 °F) for short periods.[11] Because of their notable adaptability to harsh conditions and their global introduction into many habitats for mosquito control, they have been described as the most widespread freshwater fish in the world.[18]

Environmental impact[edit]

Mosquitofish were intentionally introduced in many areas with large mosquito populations to decrease the population of mosquitoes by eating the mosquito larvae.[3] However, most introductions were ill-advised; in most cases native fish had already proven to supply maximal control of mosquito population and introducing mosquitofish has been more harmful to indigenous aquatic life than to the mosquito population.[18] Introductions outside the mosquitofish's natural range can be harmful to the nonnative ecosystems.[19][20] Mosquitofish have been known to kill or injure other small fish by their aggressive behavior and otherwise harm them through competition.[14] They are now considered just slightly better at eating mosquitoes than at destroying other aquatic species.[11] Mosquitofish in Australia are considered noxious pests where they pose a threat to native fish and frog populations and no evidence indicatesthey have controlled mosquito populations or mosquito-borne diseases.

However, from the 1920s to the 1950s, mosquitofish were a major factor in eradicating malaria in South America, in southern Russia, and in the Ukraine. A somewhat famous example of mosquitofish eradicating malaria is on the coast of the Black Sea near Sochi in Russia.[18][21][22] In Sochi, the mosquitofish is commemorated for eradicating malaria by a monument of the fish.[23][24] In 2008, in some parts of California and in Clark County, Nevada, mosquitofish were bred in aquariums so people could stock stagnant pools of water with the mosquitofish to reduce the number of West Nile virus cases.[25]

Reproduction[edit]

Reproduction of the mosquitofish starts with the male arranging the rays of the gonopodium (modified anal fin) into a slight tube. The male mosquitofish uses this tubular fin to secrete milt into the female's genital aperture in the process of internal fertilization.[3][9][26] The female's genital aperture is located just behind the anal fin and is an opening for the milt to fertilize the ova within the ovary.[9] Mosquitofish are within the infraclass Teleostei and as all teleosts, mosquitofish lack a uterus, so production of oocytes and gestation occur within the ovary of a female mosquitofish.[27][28] Inside the female, sperm from multiple males can be stored to later fertilize more ova.[3] Based on laboratory experiments, the female mosquitofish is believed to be vitellogenic in nature during spring when the average temperature reaches about 14 °C (57 °F), and then the oocytes finish maturing when the average temperature reaches about 18 °C (64 °F). Then late in the summer when the photoperiod is less than 12.5 hours long, the next clutch of oocytes lose vitellogenesis.[27] In one reproductive season, a female may fertilize, with stored milt, two to six broods of embryos, with the size of the brood decreasing as the season progresses.[1] Reproduction rates are highly dependent on temperature and ration level. As temperature increases from 20 to 30°C, mean age at first reproduction decreases from 191 to 56 days, and brood size and mass of offspring increase significantly. Interbrood interval estimates at 25 and 30°C are 23 and 19 days, respectively.[29]

Embryology[edit]

Mosquitofish have a 16- to 28-day gestation period.[10] They are lecithotrophic, which means during gestation, nutrients are provided to the embryos by a yolk sac.[30] If the gestation period is shorter, each newborn will at birth still have a yolk sac connected through a slit located on the ventral side of the body wall.[10] Brood size of females depends on the size of the given female; larger females are more capable of a larger brood quantity than smaller females. Most females, though, have a brood quantity of about 60 young.[1][3] Mosquitofish are viviparous, which means after the gestation of a brood, the female will have live birth.[26][27] In most cases, the newborn brood will have an equal male to female ratio.[1]

Growth[edit]

After birth, newborn mosquitofish are about 8 to 9 mm (0.31 to 0.35 in) in length. As juveniles, they grow at a rate of about 0.2 mm (0.0079 in) per day. Growth rates of juvenile mosquitofish reach their peak when the water temperature is within a range of 24 to 30 °C (75 to 86 °F).[31] As temperatures rise above or dip below this range, growth rates decrease. Temperatures at or above 35 °C (95 °F) are typically lethal, while growth stops when temperatures are at or below 10 °C (50 °F).[1] For male mosquitofish, sexual maturity is reached in about 43 to 62 days.[32] Female mosquitofish reach sexual maturity in about 21 to 28 days if born early within the reproductive season. The lifespan of a mosquitofish averages less than a year and the maximum is about 1.5 years. However, mosquitofish kept as pets can live much longer, with owners reporting lifespans of over three years. Male mosquitofish lifespans are considerably shorter than the hardier females.[1]

References[edit]

  1. ^ a b c d e f g Whiteside, Bobby; Bonner, Timothy; Thomas, Chad; Whiteside, Carolyn. "Gambusia affinis western mosquitofish". Texas State University. Retrieved 25 October 2011. 
  2. ^ a b Wallus & Simon 1990, p. 175
  3. ^ a b c d e f g h i j k Masterson, J. "Gambusia affinis". Smithsonian Institution. Retrieved 21 October 2011. 
  4. ^ Lund, Mark (16 November 2005). Mosquitofish: Friend or Foe? Edith Cowan University.
  5. ^ Alameda County Mosquito Abatement Program http://www.mosquitoes.org
  6. ^ Mosquitofish. Santa Clara County Vector Control District
  7. ^ Contra Costa County Mosquito and Vector Control District http://www.contracostamosquito.com/
  8. ^ Mosquitofish to fight mosquito breeding in Chennai, India
  9. ^ a b c d Kuntz, Albert (1913). "Notes on the Habits, Morphology of the Reproductive Organs, and Embryology of the Viviparous Fish Gambusia affinis". Bulletin of the United States Bureau of Fisheries (Department of Commerce) 33: 181–190. 
  10. ^ a b c Rajkumar, R (1987). "Trophic microvilli of the belated embryos of Gambusia affinis (Baird and Girard) (Atheriniformes: Poeciliidae)". Journal of the Inland Fisheries Society of India Barrackpore 19 (1): 32–36. 
  11. ^ a b c "Gambusia affinis (fish)". Global Invasive Species Database. Retrieved 21 October 2011. 
  12. ^ "Gambusia holbrooki Girard, 1859". ITIS. Retrieved 30 December 2011. 
  13. ^ Regional Office For The Eastern Mediterranean (2003). Use of Fish For Mosquito Control. World Health Organization. p. 15. Retrieved 2 January 2012. 
  14. ^ a b Nico, Leo; Fuller, Pam; Jacobs, Greg; Cannister, Matt (19 August 2009). "Gambusia affinis". USGS. Retrieved 25 October 2011. 
  15. ^ Kitching, R.l., ed. The Ecology of Exotic Animals. Milton: John Wiley and Sons, 1986. 7-25.
  16. ^ Dionne, Michele (1985). "Cannibalism, Food Availability, and Reproduction in the Mosquito Fish (Gambusia affinis): A Laboratory Experiment". The American Naturalist 126: 16–23. doi:10.1086/284392. JSTOR 2461558. 
  17. ^ Krumholz, Louis (1944). "Northward Acclimatization of the Western Mosquitofish, Gambusia affinis affinis". Copeia 1944 (2): 82. doi:10.2307/1438757. JSTOR 1438757. 
  18. ^ a b c "Гамбузия". Great Soviet Encyclopedia (in Russian). Moscow. 
  19. ^ "Aquatic Invasive Species: Gambusia affinis (Mosquito fish)". Washington Department of Fish and Wildlife. Washington Department of Fish and Wildlife. Retrieved 2 January 2012. 
  20. ^ Rupp, Henry (1995). "Adverse Assessments of Gambusia affinis". North American Native Fishes Association (NANFA). Retrieved 2 January 2012. 
  21. ^ Vinogradova 2000, p. 187
  22. ^ Ilyin, Ivan. История человека – история города Сочи (in Russian). Объявления Сочи: История человека – история города Сочи / 135 лет со дня рождения Сергея Юрьевича Соколова. Retrieved 8 November 2011. 
  23. ^ В Сочи установлен памятник рыбке, спасшей местность от малярии (in Russian). Кавказский узел. 26 June 2010. Retrieved 8 November 2011. 
  24. ^ Врачу, спасшему Сочи от малярии, поставят памятник (in Russian). ФедералПресс. 22 July 2010. Retrieved 8 November 2011. 
  25. ^ Russel, Sabin (12 July 2008). "Heat wave adds to West Nile danger". San Francisco Chronicle (San Francisco, California: SFGate). p. B–1. Retrieved 3 January 2012. 
  26. ^ a b Casal, Christine (March 23, 1993). "Reproduction of Gambusia affinis". Fish Base. Retrieved 29 December 2011. 
  27. ^ a b c Koya, Y; Kamiya, E (2000). "Environmental Regulation of Annual Reproductive Cycle in the Mosquitofish, Gambusia affinis". The Journal of experimental zoology 286 (2): 204–11. doi:10.1002/(SICI)1097-010X(20000201)286:2<204::AID-JEZ12>3.0.CO;2-G. PMID 10617862. 
  28. ^ Schindler, Joachim; Hamlett, William (1993). "Maternal–embryonic relations in viviparous teleosts". Journal of Experimental Zoology 266 (5): 378–393. doi:10.1002/jez.1402660506. 
  29. ^ Campton, D. E.; Gall, G. A. E. (1988). "Growth and reproduction of the mosquitofish, Gambusia affinis, in relation to temperature and ration level: consequences for life history". Environmental Biology of Fishes 21 (1): 45–57. doi:10.1111/j.1095-8649.1988.tb05463.x. 
  30. ^ Grier, HJ; Grier, HJ (2010). "Oogenesis of microlecithal oocytes in the viviparous teleost Heterandria formosa". J. Morphol 272 (2): 241–57. doi:10.1002/jmor.10912. PMID 21210493. 
  31. ^ Wurtsbaugh, Wayne A.; Cech, Joseph J. (1983). "Growth and activity of juvenile mosquitofish: temperature and ratio effects". Transactions of the American Fisheries Society 112 (5): 653–660. doi:10.1577/1548-8659(1983)112<653:GAAOJM>2.0.CO;2. 
  32. ^ Campton, D. E.; Gall, G. A. E. (1988). "Effect of individual and group rearing on age and size at maturity of male mosquitofish, Gambusia affinis". Journal of Fish Biology 33 (2): 203–212. doi:10.1111/j.1095-8649.1988.tb05463.x. 

Bibliography[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Gambusia holbrooki from east of the Mobile River formerly was regarded as a subspecies of G. affinis; holbrooki was elevated to full species status by Wooten et al. (1988); this change was adopted in the 1991 AFS checklist (Robins et al. 1991). Page and Burr (1991) retained holbrooki as a subspecies of affinis, noting intergradation in the Mobile Bay basin. Gambusia affinis apparently hybridizes/intergrades with G. holbrooki in some sites in the Chattahoochee and Savannah river drainages (Lydeard et al. 1991).

Member of subgenus Arthrophallus, affinis species group (Rauchenberger 1989). See Rauchenberger (1989) for a study of the interrelationships of the subgenera and species groups within the genus Gambusia. Some southwestern populations of G. affinis were regarded as a distinct species, G. specioisa, by Rauchenberger (1989); Robins et al. (1991) viewed them as, at most, a subspecies of affinis.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!