Overview

Comprehensive Description

Biology

Inhabits sand-bottomed and gravel-bottomed pools of creeks and small rivers.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (20,000-200,000 square km (about 8000-80,000 square miles)) Range includes Gulf Slope drainages from the Ochlockonee River system, Georgia and Florida, to the Tombigbee River system, Alabama (Page and Burr 2011).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Range includes Gulf Slope drainages from the Ochlockonee River system, Georgia and Florida, to the Tombigbee River system, Alabama (Page and Burr 2011).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Georgia, Florida, and Alabama, U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: Gulf Slope from Ochlockonee River system in Georgia and Florida, USA to Tombigbee River system in Alabama, USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 15 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 150 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

15.0 cm TL (male/unsexed; (Ref. 5723))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Syntype; Paralectotype for Semotilus thoreauianus Johnston & Ramsey
Catalog Number: USNM 292574
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: Ga., Georgia, United States, North America
  • Syntype: Jordan, D. S. 1877. Bulletin of the United States National Museum. No. 10: 63.; Paralectotype: Johnston, C. E. & Ramsey, J. S. 1990. Copeia. 1990 (1): 119.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype; Lectotype for Semotilus thoreauianus Johnston & Ramsey
Catalog Number: USNM 9296
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): H. Neisler
Locality: Ga., Georgia, United States, North America
  • Syntype: Jordan, D. S. 1877. Bulletin of the United States National Museum. No. 10: 63.; Lectotype: Johnston, C. E. & Ramsey, J. S. 1990. Copeia. 1990 (1): 119.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Small, clear headwater streams (Johnson and Ramsey 1990). Sand- and gravel-bottomed pools of creeks and small rivers (Page and Burr 1991). Males construct pit/ridge nests in gravel bottom. Eggs laid in nests (apparently of this species) on the bottom were in runs below pools with undercut banks (Johnson and Ramsey 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Small, clear headwater streams (Johnson and Ramsey 1990). Sand- and gravel-bottomed pools of creeks and small rivers (Page and Burr 1991). Males construct pit/ridge nests in gravel bottom. Eggs laid in nests (apparently of this species) on the bottom were in runs below pools with undercut banks (Johnson and Ramsey 1990).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 - 300

Comments: This species is represented by a large number of occurrences (subpopulations). Johnston and Ramsey (1990) mapped 73 collection sites, with 16 in Florida, 42 in Alabama, and 15 in Georgia. Boschung and Mayden (2004) mapped more than 100 collection sites from Alabama. Mettee et al. (1996) mapped 190 historical collection stations in Alabama; has been collected at 56 of these stations since 1985 and over 50% of the stations since 1980 (S. Mettee, pers. comm., 1997). Estimated 101+ extant populations rangewide (C. Gilbert, pers. comm., 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Semotilus thoreauianus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTCGTATTTGGTGCCTGGGCCGGAATAGTAGGCACCGCTTTAAGCCTTCTCATTCGGGCCGAATTGAGCCAACCAGGATCATTATTAGGGGATGATCAAATTTATAATGTCATCGTTACCGCCCACGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTCTAATTGGCGGATTTGGAAACTGACTTGTACCATTAATGATTGGTGCACCAGACATAGCATTTCCCCGAATAAATAATATAAGCTTCTGGCTTCTACCCCCTTCGTTCCTTCTACTATTAGCCTCTTCTGGAGTCGAGGCTGGGGCCGGAACCGGCTGAACAGTCTACCCACCACTTGCAGGCAATCTAGCTCATGCCGGAGCATCAGTGGACCTAACCATCTTCTCCCTACATTTAGCAGGTGTATCATCAATTTTAGGTGCAGTTAATTTTATTACTACAATTATTAACATAAAACCCCCAGCTATCTCCCAATATCAAACGCCTCTCTTCGTGTGGGCCGTGCTTGTAACAGCAGTACTTCTACTCCTATCGTTACCAGTTCTAGCTGCCGGAATTACGATACTTCTTACAGACCGAAATCTAAACACCACATTCTTTGACCCCGCTGGAGGAGGGGATCCAATCCTGTATCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Semotilus thoreauianus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, and lack of major threats. Trend over the past 10 years or three generations is uncertain but likely relatively stable, or the species may be declining but not fast enough to qualify for any of the threatened categories under Criterion A (reduction in population size).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Stable (S. Mettee and C. Gilbert, pers. comm., 1997); very stable (B. Kuhajda, pers. comm., 1997); probably stable (M. Pierson, pers. comm., 1997). In Alabama, populations show no obvious signs of stress (Boschung and Mayden 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of occurrences (subpopulations). Johnston and Ramsey (1990) mapped 73 collection sites, with 16 in Florida, 42 in Alabama, and 15 in Georgia. Boschung and Mayden (2004) mapped more than 100 collection sites from Alabama. Mettee et al. (1996) mapped 190 historical collection stations in Alabama; has been collected at 56 of these stations since 1985 and over 50% of the stations since 1980 (S. Mettee, pers. comm., 1997). Estimated 101+ extant populations rangewide (C. Gilbert, pers. comm., 1997).

This species is never found in large numbers in Alabama (Boschung and Mayden 2004), though some report it as abundant in small headwater streams (M. Pierson, pers. comm., 1997). It is common below the Fall Line (Page and Burr 2011).

Stable (S. Mettee and C. Gilbert, pers. comm., 1997); very stable (B. Kuhajda, pers. comm., 1997); probably stable (M. Pierson, pers. comm., 1997). In Alabama, populations show no obvious signs of stress (Boschung and Mayden 2004).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Comments: This species is not threatened; it occurs in small streams, and the topography of the area prevents agriculture from encroaching to the stream's edge (S. Mettee, pers. comm., 1997). No threats, very common in small to medium sized streams; one of the last species to disappear in impacted streams, even in urban settings (B. Kuhajda, pers. comm., 1997). No specific threats (C. Gilbert, pers. comm., 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
This species is not threatened; it occurs in small streams, and the topography of the area prevents agriculture from encroaching to the stream's edge (S. Mettee, pers. comm., 1997). No threats, very common in small to medium sized streams; one of the last species to disappear in impacted streams, even in urban settings (B. Kuhajda, pers. comm., 1997). No specific threats (C. Gilbert, pers. comm., 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Biological Research Needs: Determine basic life history.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Few (1-3) occurrences appropriately protected and managed

Comments: Occurs on Eglin Air Force Base in Florida; this does not necessarily afford protection (C. Gilbert, pers. comm., 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly included in S. atromaculatus; syntopic with atromaculatus without evidence of interbreeding in Black Warrior and Cahaba rivers; some evidence of hybridization in upper Tallapoosa River (Johnson and Ramsey 1990). The 1991 AFS checklist (Robins et al. 1991) followed Johnson and Ramsey (1990) in raising thoreauianus to full species status.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!