Overview

Comprehensive Description

Biology

Found in rocky areas which may be sediment-free and shallow or sediment-rich at somewhat deeper levels. Feeds at right angles with the substrate by combing loose material from the biocover. Also feeds on plankton in the open water (Ref. 5595).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Endemic to Lake Malawi where it has a lake-wide distribution.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Africa: Lake Malawi.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Africa: Endemic to Lake Malawi. Occurs on the northwestern coast between Cape Manulo and Kande Islands. Also found on Jalo Reef, at Namalenje Islands, Cape Maclear, Monkey Bay, Boadzulu Islands and Nkopola. On the eastern part, occurs at Fort Maguire, Masinje on Likoma and Chisumulu Islands (Ref. 5595).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 16 - 19; Dorsal soft rays (total): 7 - 10; Anal spines: 3 - 4; Analsoft rays: 6 - 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Max. size

11.3 cm SL (male/unsexed; (Ref. 5684))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Diagnosis: head moderately sloped; rostral tip of the neurocranium swollen; jaws isognathus; outer rows of the jaws with bicuspid teeth; absence of any interrupted pigment in the pale blue dorsal fin in combination with black bars on a blue ground; gill rakers on first ceratobranchial 8-14; gill rakers on first epibranchial 1-3 (Ref. 27596). Females with gray/blue to blue/brown ground color and no yellow pigment in unpaired fins, ocelli in anal fin present (Ref. 76849).Description: 0-3 pored scales post lateral line; 4-6 scale rows on cheek; 3-4 teeth rows on upper jaw, 3-4 on lower (Ref. 76849).Coloration: breeding males at Maleri Island: head light-blue; cheek gray/blue with yellow highlights; ventral border of cheek yellow; gular region blue/white; body bright blue with 5-7 faint gray/black bars anterior to caudal peduncle; caudal peduncle blue/gray; belly and breast gray/blue; dorsal fin pale blue; caudal fin with pale gray rays, membranes blue with trailing yellow/orange edge; anal fin blue/gray, with 1-5 orange/yellow ocelli; pelvic fin with white leading margin, membranes black anteriorly, clear posteriorly; pectoral fin with gray rays and clear membranes (Ref. 76849). Breeding males at Namalenje Island: head black with 2 light-blue interorbital bands; gular region blue/black; body light-blue with 6-8 black bars anterior to caudal peduncle; caudal peduncle dark blue/gray; belly and breast blue/black; dorsal fin pale blue; caudal fin with gray rays, membranes blue with narrow yellow/orange edge; anal fin blue/gray, with 1-5 orange/yellow ocelli, sometimes vertical bar extending onto membranes between first 3 spines; pelvic fin black with white leading margin; pectoral fin with gray rays and clear membranes (ref. 76849). Females at Maleri Island: head light brown with gray gular region; body light brown/gray; dorsal, caudal, and anal fins light brown/gray; small yellow spots on trailing edge of anal fin; pelvic fin black with white leading margin; pectoral fin with gray rays and clear membranes (Ref. 76849). Females at Namalenje Island: head dark brown/black with brown gular region; body dark brown/black with bright-blue highlights; dorsal, caudal and anal fins dark brown/black; small yellow spots on trailing edge of anal fin; pelvic fin black with white leading margin; pectoral fin with brown rays and clear membranes (Ref. 76849).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Occurs in rocky habitats (can be either sediment free or sediment rich). Feeds at right angles with the substrate combing loose material from the rock surface. It is often observed feeding on plankton from the open water. Male territories consist of caves which they defend and where spawning occurs. Females are found in groups foraging in the water column. It is a polymorphic cichlid. Known by its scientific name in the aquarium trade. Max. size: 13.5 cm (TL).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; freshwater; pH range: 8.0 - 8.0; dH range: 9 - 19; depth range 6 - 28 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits the intermediate zone. Also found in sediment covered slabs and small medium rocks. Territorial males, usually centered around a hole among the rocks in which the resident spawns or takes refuge, ritualized intraspecific fights common. Females, juveniles and non territorial adult males occur in large schools, frequently numbering hundreds of individuals as well as singly or in small groups. Non territorial fish feed in the water column, territorial males may also do when plankton is available. Sand, rock or sediment scrapers.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

White spot Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trypanosoma Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pseudomonas infection. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hole-in-the-Head Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fin Rot (early stage). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cryptobia Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bacterial Infections (general). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Produces up to 60 eggs.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Maylandia zebra

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CTCTATCTAGTATTTGGTGCTTGGGCCGGAATAGTAGGAACTGCACTTAGCCTCCTAATTCGGGCAGAACTAAGTCAGCCCGGCGCTCTCCTCGGAGAT---GACCAGATTTATAATGTAATTGTTACAGCACATGCTTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTTGGAAACTGACTAGTGCCTCTTATGATTGGTGCACCCGACATAGCTTTCCCTCGAATAAACAATATAAGCTTCTGACTCCTTCCCCCTTCATTCCTCCTCCTCCTTGCCTCTTCCGGAGTCGAAGCAGGGGCTGGCACAGGATGAACTGTTTATCCCCCACTCTCAGGCAATCTCGCCCACGCAGGGCCTTCTGTCGATTTAACCATCTTCTCCCTCCATTTGGCCGGGGTATCGTCTATTCTTGGCGCAATTAATTTTATTACAACAATTATTAACATAAAACCCCCTGCCATCTCTCAGTACCAAACACCTCTGTTTGTGTGGTCCGTCCTAATTACCGCAGTATTGCTTTTATTATCCCTGCCCGTGCTTGCTGCCGGCATCACAATACTTCTCACAGACCGAAACCTCAATACAACCTTCTTTGACCCTGCTGGAGGAGGGGACCCTATCCTTTACCAACAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Maylandia zebra

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2006

Assessor/s
Kasembe, J.

Reviewer/s
Snoeks, J. (Freshwater Fish Red List Authority) & Darwall, W. (Freshwater Biodiversity Assessment Programme)

Contributor/s

Justification
Endemic to Lake Malawi where it is widespread with no known, major and widespread threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
No information available.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
No major threats identified.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: highly commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Zebra Mbuna

The zebra mbuna (Maylandia zebra) is a species of cichlid endemic to Lake Malawi in Africa. This species can reach a length of 11.3 cm (4.4 in). It feeds on aufwuchs, a surface layer of mostly algal material that grows on rocks. This cichlid is a mouthbrooder and the female broods the eggs in her mouth for about three weeks. This fish can sometimes be found in the aquarium trade.

Description[edit]

The zebra mbuna has a single dorsal fin with sixteen to nineteen spines and seven to ten soft rays. The anal fin has three to four spines and six to nine soft rays. It grows to a maximum length of 11.3 cm (4.4 in) SL.[2] The male fish varies in colour in different parts of its range, in some locations having a dark head, throat and belly and in others a blue head, whitish throat and grey/blue belly. In both cases the body is bright blue with up to eight grey/black bars, the dorsal fin is blue and the anal fin is blue to grey, with one to five orange to yellow spots. The female zebra mbuna is polymorphic, that is to say it occurs in two different colour forms. In one morph the head and body colour is pale brownish-grey, with similar coloured dorsal, anal and caudal fins, the pectoral fins have grey rays and clear membranes, and the black pelvic fins have white leading edges. In the other colour morph the throat is brown and the head and body are dark brown to black, the body having blue highlights. The dorsal and caudal fins are a similar brown/black colour and so are the anal fins, but on them, the trailing edges have a number of yellow spots. The pectorals have brown rays and clear membranes, and the black pelvic fins have white leading edges.[3]

Distribution and habitat[edit]

The zebra mbuna is endemic to Lake Malawi where it is found in rocky areas, both where there is sediment and where the rock is bare[1] at depths between 6 and 28 m (20 and 92 ft).[2]

Biology[edit]

The zebra mbuna largely feeds on aufwuchs, an algae-based community of organisms adhering to rock surfaces. It also consumes zooplankton and small invertebrates. It's mobile mouth is at the tip of its snout with bicuspid teeth at the front and widely-spaced tricuspid teeth behind. It holds its body at right angles to the rock and presses its mouth against the surface, repeatedly opening and closing it, and these actions scrape off the loose aufwuchs which it then ingests.[4]

The zebra mbuna is a maternal mouth brooding cichlid. The female broods the eggs and early stage young in her mouth for 18 to 24 days. During this time she is unable to feed and she loses weight. When mature enough, the fry are expelled into the open water and quickly find natural shelter in which to hide. A study by Pierottia et al (2008) investigated whether the colour morph of the female influenced the male's choice of mate. It was found that the male's preference in mate colouring was best predicted by the colour morph of his mother and that he was not influenced in his choice by his rearing experience.[5]

Use in aquaria[edit]

Zebra mbuna

The male zebra mbuna is an aggressive fish and not recommended as an aquarium fish for a novice keeper of Malawian cichlids. This fish tends to grow bigger in captivity than in the wild, sometimes exceeding 13 cm (5 in) in length. It appreciates a large tank with plenty of rocks or places to hide and a group of three to five females with a single male is suitable. A fish such as the Australian rainbowfish (Melanotaenia fluviatilis) can be used as a dither fish to distract the male.[6]

References[edit]

  1. ^ a b Kasembe, J. 2006. Maylandia zebra. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. <www.iucnredlist.org>. Downloaded on 24 April 2013.
  2. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2013). "Maylandia zebra" in FishBase. February 2013 version.
  3. ^ "Morphology Data of Maylandia zebra". FishBase. Retrieved 2014-05-27. 
  4. ^ Oliver, M. K. (2014-04-16). "Aufwuchs: Pseudotropheus (Maylandia) zebra". The cichlid fishes of Lake Malawi, Africa. MalawiCichlids.com. Retrieved 2014-05-27. 
  5. ^ Pierottia, Michele E.R.; Knight, Mairi E.; Immler, Simone; Barson, Nicola J.; Turner, George F.; Seehausen, Ole (2008). "Individual variation in male mating preferences for female coloration in a polymorphic cichlid fish". Behavioral Ecology 19 (3): 483–488. doi:10.1093/beheco/arm154. 
  6. ^ Oliver, M. K. (2009-04-29). "Maylandia zebra". The cichlid fishes of Lake Malawi, Africa. MalawiCichlids.com. Retrieved 2014-05-27. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!