Overview

Comprehensive Description

Biology

A benthopelagic mid-slope species, that appears to wander off slope bottoms into midwater (Ref. 1371). Adults feed on small fish, euphausiids, prawns, amphipods and cephalopods (Ref. 1371). Oviparous, with planktonic larvae (Ref. 36385).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

North Pacific: northern Japan to Okhotsk and Bering seas, south along North American coasts to northern Mexico.
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 2; Dorsal soft rays (total): 122; Analspines: 0; Analsoft rays: 94
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 870 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

104 cm TL (male/unsexed; (Ref. 56527)); max. published weight: 3,000 g (Ref. 56476); max. reported age: 73 years (Ref. 35883)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Head large, scaled completely except for a narrow ventrolateral strip on snout; eyes also large; snout short, pointed and with tubercular scales along its leading edge; chin with a small chin barbel. Body tapering to a point posteriorly from behind the insertion of the first dorsal-fin spine. Scales adherent, with 3 to 5 divergent rows of coarse spinules. Pyloric caeca 12 to 14. Overall color is gray to grayish-brown in young, turning to dark brown in adults; fins generally dark. Branchiostegal rays: 6-6 (Ref. 36385).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Coryphaenoides acrolepis
Catalog Number: USNM 48772
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1895
Locality: Bering Sea S.W. of Pribilof Is., Alaska, United States, Pribilof Islands, Bering Sea, Pacific
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Coryphaenoides acrolepis
Catalog Number: USNM 32496
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Swan
Year Collected: 1883
Locality: Off Cape Flattery, Wash. Ter., Washington, United States, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

bathydemersal; non-migratory; marine; depth range 300 - 3700 m (Ref. 50550), usually 900 - 1300 m (Ref. 56476)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 57 specimens in 1 taxon.
Water temperature and chemistry ranges based on 47 samples.

Environmental ranges
  Depth range (m): 146 - 50000
  Temperature range (°C): 1.710 - 6.911
  Nitrate (umol/L): 23.769 - 45.195
  Salinity (PPS): 33.506 - 34.629
  Oxygen (ml/l): 0.464 - 3.639
  Phosphate (umol/l): 2.205 - 3.485
  Silicate (umol/l): 38.555 - 179.332

Graphical representation

Depth range (m): 146 - 50000

Temperature range (°C): 1.710 - 6.911

Nitrate (umol/L): 23.769 - 45.195

Salinity (PPS): 33.506 - 34.629

Oxygen (ml/l): 0.464 - 3.639

Phosphate (umol/l): 2.205 - 3.485

Silicate (umol/l): 38.555 - 179.332
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 155 - 2500m.
From 155 to 2500 meters.

Habitat: benthopelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeds on fish, cephalopods and crustaceans (Ref. 1371).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous (Ref. 36385).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 73 years (wild) Observations: Some estimates suggest these animals live over 73 years (Cailliet et al. 2001).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Coryphaenoides acrolepis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Coryphaenoides acrolepis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GATATTGGCACTCTATACCTCGTATTTGGTGCCTGAGCCGGAATAGTGGGGACTGCTTTAAGTCTTCTTATCCGAGCCGAACTCAGCCAGCCTGGCGCACTCCTGGGCGACGATCAAATTTACAATGTTATTGTTACGGCGCACGCATTCGTAATAATTTTCTTTATGGTCATGCCTTTAATAATCGGGGGCTTCGGAAATTGACTTGTCCCCTTAATAATTGGCGCCCCTGATATGGCCTTTCCACGAATAAATAATATAAGCTTCTGACTTCTCCCTCCCTCACTCCTGCTCCTTCTAGCATCTTCTGGTGTAGAAGCCGGGGCTGGGACCGGATGAACTGTTTACCCCCCTCTAGCCGGCAACCTCGCCCACGCAGGGGCATCCGTGGATTTAACAATTTTCTCTCTTCATCTGGCTGGTATTTCCTCAATTCTCGGGGCAATTAATTTTATTACTACCATTATTAATATAAAACCCCCAGCCATCACCCAGTACCAAACACCTTTATTTGTCTGATCCGTATTAATTACAGCAGTTCTCCTTTTACTCTCTCTCCCTGTGCTAGCAGCTGGGATTACGATACTCCTAACAGACCGAAATCTTAATACCTCCTTCTTCGACCCGGCCGGTGGAGGTGACCCCATTCTATACCAACACCTCTTCTGATTCTTCGGC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!