Overview

Comprehensive Description

Description

  Common names: sand-bass (English), cabrilla (Espanol)
 
Paralabrax auroguttatus Walford, 1936


Gold-spotted sand-bass,     Goldspotted sand-bass


Body elongate, compressed, body depth 3.0-3.2 in SL; head pointed; mouth large; preopercle finely serrated; 13-14 gill rakers; dorsal rays X, 13-14,  third spine greatly elevated, over three times longer than second, end of fin pointed; anal rays III, 6-8; pectoral rays 16; lateral line 73.

Overall brownish becoming white ventrally; head and sides covered with numerous golden orange to brownish spots; back with 2-3 thin pale stripes; lining of gill cavity orange; juveniles white with three dark brown stripes and a lighter brown stripe or longitudinal row of spots between each dark stripe, the stripes break up into spots with increased growth.


Size: to at least 71 cm.

Inhabits rocky bottoms.

Depth: 2-183 m.

Central Baja to the Gulf of California to central Mexico.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Found on rocky bottoms, between 40 and 107 m depth. An important game fish.
  • Heemstra, P.C. 1995 Serranidae. Meros, serranos, guasetas, enjambres, baquetas, indios, loros, gallinas, cabrillas, garropas. p. 1565-1613. In W. Fischer, F. Krupp, W. Schneider, C. Sommer, K.E. Carpenter and V. Niem (eds.) Guia FAO para Identification de Especies para lo Fines de la Pesca. Pacifico Centro-Oriental. 3 Vols. FAO, Rome. (Ref. 9342)   http://www.fishbase.org/references/FBRefSummary.php?id=9342&speccode=8727 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is endemic to the Eastern Pacific, and is found from central Baja California and the Gulf of California to central Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, East Pacific endemic, TEP non-endemic

Regional Endemism: All species, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California province, primarily, Continent, Continent only

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Central Pacific: Baja California, Mexico and the Gulf of California.
  • Heemstra, P.C. 1995 Serranidae. Meros, serranos, guasetas, enjambres, baquetas, indios, loros, gallinas, cabrillas, garropas. p. 1565-1613. In W. Fischer, F. Krupp, W. Schneider, C. Sommer, K.E. Carpenter and V. Niem (eds.) Guia FAO para Identification de Especies para lo Fines de la Pesca. Pacifico Centro-Oriental. 3 Vols. FAO, Rome. (Ref. 9342)   http://www.fishbase.org/references/FBRefSummary.php?id=9342&speccode=8727 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 2 (S) - 183 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 71.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 710 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

71.0 cm TL (male/unsexed; (Ref. 9342)); max. published weight: 2,720 g (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Paralabrax auroguttatus
Catalog Number: USNM 100981
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Walford
Year Collected: 1935
Locality: Guaymas, Mexico, Sonora, Mexico, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This demersal species is found on rocky and rubble substrata between two and 183 m depth.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; marine; depth range 40 - 107 m (Ref. 9342)
  • Heemstra, P.C. 1995 Serranidae. Meros, serranos, guasetas, enjambres, baquetas, indios, loros, gallinas, cabrillas, garropas. p. 1565-1613. In W. Fischer, F. Krupp, W. Schneider, C. Sommer, K.E. Carpenter and V. Niem (eds.) Guia FAO para Identification de Especies para lo Fines de la Pesca. Pacifico Centro-Oriental. 3 Vols. FAO, Rome. (Ref. 9342)   http://www.fishbase.org/references/FBRefSummary.php?id=9342&speccode=8727 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 8 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 1 - 12
  Temperature range (°C): 20.794 - 24.554
  Nitrate (umol/L): 0.162 - 5.631
  Salinity (PPS): 34.642 - 35.311
  Oxygen (ml/l): 4.733 - 4.912
  Phosphate (umol/l): 0.429 - 1.098
  Silicate (umol/l): 3.286 - 12.886

Graphical representation

Depth range (m): 1 - 12

Temperature range (°C): 20.794 - 24.554

Nitrate (umol/L): 0.162 - 5.631

Salinity (PPS): 34.642 - 35.311

Oxygen (ml/l): 4.733 - 4.912

Phosphate (umol/l): 0.429 - 1.098

Silicate (umol/l): 3.286 - 12.886
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 40 - 107m.
From 40 to 107 meters.

Habitat: demersal. Found on rocky bottoms, between 40 and 107 m depth. An important game fish.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Reef (rock &/or coral), Reef only, Rocks, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Demersal
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), octopus/squid/cuttlefish, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Paralabrax auroguttatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATCTAGTATTTGGTGCCTGAGCCGGAATAGTAGGAACAGCCCTAAGCCTTCTTATTCGAGCCGAGCTCAGCCAACCGGGCGCTCTCTTAGGAGACGACCAGATCTACAATGTAATTGTTACAGCACACGCTTTCGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGAGGGTTCGGAAACTGACTTATCCCTTTAATGATTGGAGCCCCTGATATAGCATTCCCTCGAATAAATAACATAAGCTTTTGACTCCTTCCCCCTTCTTTCCTTCTTCTCTTAGCTTCCTCAGGGGTTGAAGCAGGAGCAGGTACAGGCTGAACAGTCTACCCTCCATTAGCCGGTAACCTGGCCCACGCCGGAGCTTCTGTTGATTTAACAATCTTTTCCCTTCATTTAGCAGGTGTCTCTTCAATTTTAGGGGCAATTAATTTTATTACTACAATTATTAATATGAAACCCCCCGCTATTTCTCAATACCAAACACCTTTATTTGTATGAGCTGTTCTAATTACTGCAGTACTGCTTCTTCTGTCCCTCCCAGTCCTTGCCGCAGGTATTACAATACTTTTAACCGATCGAAATTTAAATACAACATTCTTTGATCCTGCAGGAGGTGGAGACCCTATCCTCTACCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Paralabrax auroguttatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Findley, L., Lea, B., Allen, G. & Edgar, G.

Reviewer/s
Carpenter, K., Polidoro, B. & Livingstone, S. (Global Marine Species Assessment Team)

Contributor/s

Justification
This species is endemic to the Eastern Pacific, and is restricted to Baja California, the Gulf of California, and central Mexico. Although it occurs in deeper waters, it is an important commerical and sport fish, and its distribution occurs in a region that is heavily fished. Given that a continued decrease in mean body size has been observed in fisheries landings of this species since the 1980s, more information is needed on the effect of fisheries on this species' population, including its life history, population trends, and harvest levels. It is listed as Data Deficient.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no population information available for this species. However, individuals in fish catch landings appear to have declined substantially in mean size from the 1980s to present in the Gulf of California (Findley pers. comm.). The landings indicate that this species is moderately common in the Gulf of California, where most of the total population is likely located.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Individuals in fish catch landings appear to have declined substantially in mean size since the 1980s, however more information is needed to determine if fishing activities are having an impact on this species' population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known species specific conservation measures. However, this species' distribution includes a number of Marine Protected Areas in the Gulf of California
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
  • Heemstra, P.C. 1995 Serranidae. Meros, serranos, guasetas, enjambres, baquetas, indios, loros, gallinas, cabrillas, garropas. p. 1565-1613. In W. Fischer, F. Krupp, W. Schneider, C. Sommer, K.E. Carpenter and V. Niem (eds.) Guia FAO para Identification de Especies para lo Fines de la Pesca. Pacifico Centro-Oriental. 3 Vols. FAO, Rome. (Ref. 9342)   http://www.fishbase.org/references/FBRefSummary.php?id=9342&speccode=8727 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!