Overview

Comprehensive Description

Biology

An inshore species of the continental and insular shelves, commonly inhabiting shallow waters close inshore, near the surf line and along beaches (Ref. 244). May also be found in shallow bays and estuaries, as well as off the open coast but not ascending rivers (Ref. 9997). Predominantly demersal but found throughout the water column (Ref. 6871). Feeds on pelagic and demersal bony fishes, sharks and rays, squid, shrimps, cuttlefish, octopi, lobsters, gastropods and mammalian carrion (Ref. 5578, 9997). Viviparous (Ref. 50449). Potentially dangerous but not recorded in shark attacks to date (Ref. 9997). Utilized fresh and dried-salted for human consumption (Ref. 9997).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Eastern Atlantic: Nigeria. Indo-West Pacific: Gulf of Aden, South Africa, Madagascar, Pakistan, Sri Lanka, Indonesia, Papua New Guinea (Ref. 6871), and Australia. Also reported from the Mediterranean (Ref. Often confused with sympatric Carcharhinus leucas and Glyphis gangeticus but the three are distinguishable.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The Pigeye Shark is sporadically distributed in tropical and subtropical waters of the Indo-West Pacific Ocean, including the east coast of southern Africa, Madagascar, Gulf of Aden, Pakistan, India, Sri Lanka, Indonesia and northern Australia (Bass et al. 1973, Compagno 1984, Last and Stevens 1994). Compagno (1984) indicates several localities in the Indo-West Pacific where its suspected occurrence awaits confirmation. It also occurs in Nigeria (Compagno 1984). This species inhabits coastal waters, usually close to the bottom. It also occasionally enters brackish water (Last and Stevens 1994).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This subpopulation occurs in the Southwest Indian Ocean from Madagascar, Mozambique and South Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Djibouti, Madagascar, Mauritius, Mozambique, Somalia, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in tropical and subtropical seas (including Madagascar, Mascarenes), but except Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 2800 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

280 cm TL (male/unsexed; (Ref. 2334))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

A massive shark with a thick-set head, a short, broad and blunt snout, small eyes and large, triangular, saw-edged upper teeth; 1st dorsal fin high and erect, at leas 3.2 times height of 2nd dorsal fin; no interdorsal ridge (Ref. 5578). Grayish in color, white below; fins with dusky tips (Ref. 5578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

An inshore species of the continental and insular shelves, commonly found in shallow waters close inshore, near the surf line and along beaches. Sometimes ascends rivers. Feeds on bottom fishes (croakers, soles, hairtails, sharp-nosed sharks and other species, skates, shrimps, cuttlefish, sea snails), crustaceans and molluscs. Apparently viviparous. Size at birth about 71 to 72 cm. Potentially dangerous. Utilized fresh for human consumption.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; brackish; marine; depth range 0 - 150 m (Ref. 9997)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The following information, unless otherwise acknowledged, is based on studies by Stevens and McLoughlin (1991) in northern Australia and Cliff and Dudley (1991) in KwaZulu-Natal, South Africa.

Males mature at about 210 cm and females at 215?220 cm. The largest Australian individuals were a 231 cm male and a 242 cm female; in South Africa they were a 238 cm male and a 245 cm female. Fourmanoir (1961) recorded a 280 cm female from west Madagascar. Size at birth is 60?75 cm. In Australia the largest embryo was 59 cm and the smallest free-swimming individual was 66 cm. In South Africa the smallest free-swimming individual was 75 cm (Bass et al. 1973) and the largest embryo 79 cm. These findings imply that there may be a regional difference in size at birth. Litter sizes range from 3?13, averaging five in South Africa and nine in Australia. In South Africa gestation appears to be about 12 months, with mating in January?February and term embryos found in December?January. Five out of eight South African mature females were pregnant. Data from Australia indicated a nine-month gestation, with birth in November?December. In both studies males and females were sampled in equal numbers.

In South Africa, the Pigeye Shark feeds on teleosts (62% frequency of occurrence), elasmobranchs (45%), crustaceans (13%) and cephalopods (12%). Most of the prey were demersal, associated with soft bottoms; Australian sharks had similar diets. Tag returns from juveniles in Australia indicated that their movements are relatively localised (up to 60 km), while two larger sharks moved 240 and 1,080 km (Last and Stevens 1994). On the east coast of South Africa, two tagged sharks were recaptured after 76 and 320 days, 23 and 84 km from their respective tagging localities. Based on catches in the nets that protect the swimming beaches of KwaZulu-Natal, this species is often solitary and does not appear to swim in large packs. No information is available on age and growth.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The following information, unless otherwise acknowledged, is based on studies by Stevens and McLoughlin (1991) in northern Australia and Cliff and Dudley (1991) in KwaZulu-Natal, South Africa.

Males mature at about 210 cm and females at 215–220 cm. The largest Australian individuals were a 231 cm male and a 242 cm female; in South Africa they were a 238 cm male and a 245 cm female. Fourmanoir (1961) recorded a 280 cm female from west Madagascar. Size at birth is 60–75 cm. In Australia the largest embryo was 59 cm and the smallest free-swimming individual was 66 cm. In South Africa the smallest free-swimming individual was 75 cm (Bass et al. 1973) and the largest embryo 79 cm. These findings imply that there may be a regional difference in size at birth. Litter sizes range from 3–13, averaging five in South Africa and nine in Australia. In South Africa gestation appears to be about 12 months, with mating in January–February and term embryos found in December–January. Five out of eight South African mature females were pregnant. Data from Australia indicated a nine-month gestation, with birth in November–December. In both studies males and females were sampled in equal numbers.

In South Africa, the Pigeye Shark feeds on teleosts (62% frequency of occurrence), elasmobranchs (45%), crustaceans (13%) and cephalopods (12%). Most of the prey were demersal, associated with soft bottoms; Australian sharks had similar diets. Tag returns from juveniles in Australia indicated that their movements are relatively localised (up to 60 km), while two larger sharks moved 240 and 1,080 km (Last and Stevens 1994). On the east coast of South Africa, two tagged sharks were recaptured after 76 and 320 days, 23 and 84 km from their respective tagging localities. Based on catches in the nets that protect the swimming beaches of KwaZulu-Natal, this species is often solitary and does not appear to swim in large packs. No information is available on age and growth.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 35.5 - 48.5
  Temperature range (°C): 25.737 - 26.525
  Nitrate (umol/L): 0.732 - 0.807
  Salinity (PPS): 35.048 - 35.095
  Oxygen (ml/l): 4.529 - 4.572
  Phosphate (umol/l): 0.121 - 0.209
  Silicate (umol/l): 0.869 - 3.945

Graphical representation

Depth range (m): 35.5 - 48.5

Temperature range (°C): 25.737 - 26.525

Nitrate (umol/L): 0.732 - 0.807

Salinity (PPS): 35.048 - 35.095

Oxygen (ml/l): 4.529 - 4.572

Phosphate (umol/l): 0.121 - 0.209

Silicate (umol/l): 0.869 - 3.945
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 100m.
Recorded at 100 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs on the continental shelf (Ref. 75154). Feeds on fish, cephalopods, crustaceans and mollusks (Ref. 5578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Viviparous, placental (Ref. 50449), with 3 to 13 in a litter (Ref. 9997). Size at birth about 43 to 53 cm TL (Ref. 9997); 60-70 cm TL (Ref.58048). Distinct pairing with embrace (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carcharhinus amboinensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACTTGATTTTTGGTGCATGAGCAGGTATAGTTGGAACAGCCCTAAGTCTTCTAATTCGAGCTGAACTTGGACAACCTGGATCACTTTTAGGGGATGATCAGATCTACAATGTAATCGTAACCGCCCACGCCTTTGTAATAATCTTTTTCATAGTTATACCAATCATAATCGGTGGTTTTGGAAATTGATTAGTTCCTTTAATAATTGGTGCACCAGATATAGCCTTCCCACGAATAAATAACATAAGTTTCTGACTTCTTCCACCATCATTTCTTCTTCTCCTTGCCTCTGCTGGAGTAGAAGCTGGAGCAGGTACCGGTTGAACAGTTTATCCTCCATTAGCTAGCAACTTAGCACATGCTGGACCATCTGTTGATTTAGCTATTTTTTCTCTTCACTTAGCCGGTGTTTCATCAATTTTAGCTTCAATTAATTTTATCACAACTATTATCAACATAAAACCACCAGCCATTTCCCAATATCAAACACCATTATTTGTTTGATCTATTCTTGTAACCACTATTCTTCTTCTCCTCTCACTTCCAGTCCTTGCAGCAGGAATTACAATATTACTTACTGATCGTAACCTCAATACTACATTCTTTGATCCTGCAGGTGGAGGAGACCCAATCCTTTATCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Carcharhinus amboinensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 66
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Cliff, G.

Reviewer/s
Musick, J.A. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
This assessment is based on the information published in the 2005 shark status survey (Fowler et al. 2005).

The Pigeye Shark (Carcharhinus amboinensis) is sporadically distributed in the Indo-West Pacific, which may, in part, be due to an inability to distinguish it from other members of the genus Carcharhinus, especially the Bull Shark (C. leucas). Where fisheries data are available, this species constitutes a very small component of the catch, suggesting that it may not be common. Given its apparently sporadic distribution and low abundance, this shark may be unable to sustain heavy, localised fishing pressure. In the absence of further information, it is classified globally as Data Deficient. However, data are available from South Africa demonstrating a significant declining trend in catches, hence the Near Threatened assessment for the Southwest Indian Ocean Subpopulation.

History
  • 2000
    Data Deficient
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Cliff, G.

Reviewer/s
Musick, J.A. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
This assessment is based on information in the 2005 shark status survey (Fowler et al. 2005).

Pigeye Shark (C. amboinensis) is sporadically distributed in the Indo-West Pacific, which may, in part, be due to an inability to distinguish it from other members of the genus Carcharhinus. Where fisheries data are available, this species constitutes a very small component of the catch, suggesting that it may not be common. Natal Sharks Board data demonstrate a significant declining trend in catches from 1978–98, and a decrease in mean length in the southwest Indian Ocean. The apparently sporadic distribution and low abundance of this shark suggests that it may be unable to sustain heavy, localised fishing pressure, and shark fisheries are intensifying in the Indo-Pacific.

History
  • 2000
    Lower Risk/near threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
This species is caught in small numbers for its meat and fins in the Northern Shark Fishery which comprises longlining and pelagic and demersal gillnetting off northern Australia (Stevens and McLoughlin 1991, Last and Stevens 1994, McLoughlin et al. 1994). The Northern Pelagic Fish Stock Programme sampled in this fishing area with similar gear between January 1984?May 1985 and found that C. amboinensis comprised 0.5% of the pelagic gillnet and 3.5% of the longline catch of sharks (Bentley 1996).

Pigeye Shark constituted 0.5% (16 specimens) of the annual shark catch in the nets protecting swimming beaches in KwaZulu-Natal. The catch rate fluctuated at about 0.4 sharks per km of net per year between 1978?1990; data from the early years of this fishery (1952?1977) are not available. Richards Bay, the northernmost netted beach, where nets were introduced in 1981, had the highest catch of this species (annual average six, range 0?25). At this locality there was a significant decline in catch rates (Cliff and Dudley 1991), suggesting highly localised depletion. Immature sharks dominated the catches in all the above fisheries, and mature sharks may occur to the north of the netted region in this area.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
This species constituted 0.5 % (16 specimens) of the annual shark catch in the nets protecting swimming beaches in KwaZulu-Natal. The catch rate fluctuated at about 0.4 sharks per km of net per year between 1978–1990; data from the early years of this fishery (1952–1977) are not available. Richards Bay, the northernmost netted beach, where nets were introduced in 1981, had the highest catch of this species (annual average six, range 0–25). At this locality there was a significant decline in catch rates (Cliff and Dudley 1991), suggesting highly localised depletion.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Given the low incidence of this species in commercial catches, there are no known conservation and management initiatives.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Actions

Conservation Actions
There are no known conservation and management initiatives.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pigeye shark

The pigeye shark or Java shark (Carcharhinus amboinensis) is an uncommon species of requiem shark, family Carcharhinidae, found in the warm coastal waters of the eastern Atlantic and western Indo-Pacific. It prefers shallow, murky environments with soft bottoms, and tends to roam within a fairly localised area. With its bulky grey body, small eyes, and short, blunt snout, the pigeye shark looks almost identical to (and is often confused with) the better-known bull shark (C. leucas). The two species differ in vertebral count, the relative sizes of the dorsal fins, and other subtle traits. This shark typically reaches lengths of 1.9–2.5 m (6.2–8.2 ft).

The pigeye shark is an apex predator that mostly hunts low in the water column. It has a varied diet, consisting mainly of bony and cartilaginous fishes but also including crustaceans, molluscs, sea snakes, and cetaceans. This species gives birth to live young, with the developing embryos sustained to term via a placental connection to their mother. Litters of three to thirteen pups are born after a gestation period of nine or twelve months. Young sharks spend their first few years of life in sheltered inshore habitats such as bays, where their movements follow tidal and seasonal patterns. The pigeye shark's size and dentition make it potentially dangerous, though it has not been known to attack humans. It is infrequently caught by fisheries, which use it for meat and fins, and in shark nets used to protect beaches. The International Union for Conservation of Nature (IUCN) presently lacks adequate data to assess the conservation status of this species.

Contents

Taxonomy [edit]

Drawing of Triaenodon obtusus, a synonym of C. amboinensis, from Francis Day's Fauna of British India (1889)

German biologists Johannes Müller and Jakob Henle described the pigeye shark as Carcharias (Prionodon) amboinensis in their 1839 Systematische Beschreibung der Plagiostomen. Later authors reassigned it to the genus Carcharhinus. The type specimen is a stuffed, 74 cm (29 in) long female originally caught off Ambon Island in Indonesia, from which the specific epithet is derived.[3][4] Several junior synonyms are known for this species, among them Triaenodon obtusus, which was based on a near-birth pigeye shark foetus.[4]

Phylogeny and evolution [edit]

Since the pigeye shark so strongly resembles the bull shark, morphology-based phylogenetic studies have considered the two species to be closely related.[5][6] Neither this nor any other arrangement is strongly supported by molecular phylogenetic research, which to date has been inconclusive regarding this shark's evolutionary relationship to other Carcharhinus species.[7][8]

Genetic analysis of pigeye sharks across northern Australia suggest that the evolutionary history of this species was affected by coastline changes during the Pleistocene epoch (2.6 million to 12,000 years ago). The patterns of diversity found in its mitochondrial DNA are consistent with the repeated splitting and merging of its ancestral populations as geographical barriers were alternately formed and inundated. The most recent of these barriers was a land bridge across the Torres Strait that re-opened only some 6,000 years ago; as a result, there is significant genetic separation between the sharks found off Western Australia and the Northern Territory and those found off Queensland.[9]

Description [edit]

The pigeye shark (top) closely resembles the bull shark (bottom); external differences between the two species include the relative sizes of the dorsal fins and the angle of the notch in the anal fin.

The pigeye shark is a very robust-bodied species with a short, broad, and rounded snout. The small and circular eyes are equipped with nictitating membranes. The anterior rims of the nostrils bear medium-sized flaps of skin. The mouth forms a wide arch and has barely noticeable furrows at the corners. There are 11–13 (usually 12) upper and 10–12 (usually 11) lower tooth rows on each side; in addition, there are single rows of tiny teeth at the upper and lower symphyses (jaw midpoints). The teeth are broad and triangular with serrated edges; those in the lower jaw are slightly narrower, more upright, and more finely serrated than those in the upper. The five pairs of gill slits are of moderate length.[2][4][10]

The first dorsal fin is large and triangular, with a pointed apex and a concave trailing margin; it originates roughly over the posterior insertions of the pectoral fins. The second dorsal fin is less than a third as high as the first, and originates ahead of the anal fin. There is no midline ridge between the dorsal fins. The long pectoral fins are broad and slightly falcate (sickle-shaped), becoming narrow and pointed at the tips. The anal fin has a sharply notched trailing margin. The caudal peduncle has a deep notch on its upper surface at the caudal fin origin. The caudal fin is asymmetrical, with a well-developed lower lobe and a longer upper lobe with a notch in the trailing margin near its tip.[2][4][10]

The skin is covered by rather large dermal denticles, which become more tightly packed and overlapping with age; each denticle bears three to five horizontal ridges and five posterior teeth.[2] This species is grey above and white below, with a faint pale band on the flanks. The second dorsal fin and lower caudal fin lobe darken at the tips, particularly in juveniles.[4] An albino individual was caught off Queenland in 1987, which was the first known example of albinism in a requiem shark.[11] An adult pigeye shark typically measures 1.9–2.5 m (6.2–8.2 ft) long, while the largest individuals reach 2.8 m (9.2 ft) long.[2]

The pigeye shark can be most reliably distinguished from the bull shark by the number of precaudal (before the caudal fin) vertebrae (89–95 in C. amboinensis versus 101–123 in C. leucas). Externally, it has a greater size difference between its dorsal fins (first-to-second height ratio >3.1:1 versus ≤3.1:1 in C. leucas) and the notch in its anal fin margin forms an acute angle (versus a right angle in C. leucas). This species also usually has fewer tooth rows in the lower jaw (10–12 on each side versus 12–13 in C. leucas).[2][4]

Distribution and habitat [edit]

Though widely distributed in the tropical and subtropical marine waters of Eurasia, Africa, and Oceania, the pigeye shark does not appear to be common anywhere. Existing records are patchy, and the full extent of its range may be obscured by confusion with the bull shark.[1] In the eastern Atlantic, it is found off Cape Verde and Senegal, and from Nigeria to Namibia;[2] there is a single Mediterranean record from off Crotone, Italy.[12] It occurs all along the continental periphery of the Indian Ocean, from eastern South Africa to the Arabian Peninsula (including Madagascar, the Seychelles, and Mauritius), to Southeast Asia and northern Australia. Its range extends into the Pacific, northward to the Philippines and southern China, and eastward to New Guinea and some Micronesian islands.[2] Tagging and genetic data indicate that pigeye sharks, particularly juveniles, are not strongly migratory and tend to remain in a local area. The longest recorded distance covered by an adult is 1,080 km (670 mi).[9][10]

The pigeye shark inhabits coastal waters down to a depth of 150 m (490 ft), favouring environments with fine sediment and murky water. It sometimes enters estuaries, but unlike the bull shark it does not ascend rivers and avoids brackish water.[2][13] The movements and habitat usage of juvenile pigeye sharks have been extensively studied in Cleveland Bay in northeastern Queensland. Young sharks live in the bay year-round, staying mostly in the eastern side where the input from three rivers produces strong currents and high turbidity. Individual home ranges are relatively small, averaging 30 km2 (12 sq mi), and increase in size with age. The juveniles generally stay in water less than 40 m (130 ft) deep, with the youngest sharks spending the most time in the shallowest parts of the bay. They swim into the intertidal zone with the rising tide and depart as the tide recedes; this movement may relate to exploiting foraging opportunities on the submerged mud flats, or to avoiding predation or competition by staying out of the deeper waters occupied by larger sharks. There is also an annual movement cycle where the juveniles move closer to the river mouths during the dry season and farther from them during the wet season; since the rainy season brings a higher flow of fresh water into the bay, the sharks may be responding directly or indirectly to the resultant decrease in salinity and dissolved oxygen levels.[14][15]

Biology and ecology [edit]

The pigeye shark is a largely solitary animal, though occasionally several individuals may be found at the same location.[13] In the Mozambique Channel, it outnumbers the bull shark on the east side while the opposite is true on the west side, suggesting there may be competitive exclusion between these similar species.[4] Parasites documented from the pigeye shark include the myxosporean Kudoa carcharhini,[16] the copepods Pandarus smithii and P. cranchii,[17] and the tapeworms Callitetrarhynchus gracilis,[18] Cathetocephalus sp.,[19] Floriceps minacanthus,[20] Heteronybelinia australis,[21] Otobothrium australe, O. crenacolle,[22] and Protogrillotia sp.[18] Young pigeye sharks are potentially vulnerable to predation by larger sharks. The natural mortality for juveniles in Cleveland Bay has been measured at no more than 5% per year; this rate is comparable to that in juvenile bull sharks, and is much lower than in juvenile blacktip sharks (C. limbatus) or lemon sharks (Negaprion brevirostris).[23]

Feeding [edit]

Guitarfishes and other cartilaginous fishes are preyed upon by the pigeye shark, particularly off South Africa.

Though the pigeye shark will take prey from anywhere in the water column, it tends to hunt close to the sea floor.[13] An apex predator, it feeds mainly on teleost fishes such as croakers, flatfishes, and cutlassfishes, and to a lesser extent on cartilaginous fishes, cephalopods, and decapod crustaceans. It has also been recorded eating gastropods, sea snakes, dolphins, and whale carrion.[4][24] Other sharks and rays figure much more prominently in the diets of South African pigeye sharks than those from other regions; the types consumed include requiem sharks, catsharks, angel sharks, guitarfishes, stingrays, and eagle rays.[13]

Life history [edit]

The pigeye shark is viviparous; like in other requiem sharks, after the developing embryo depletes its supply of yolk, it is sustained to term by its mother through a placental connection formed from the empty yolk sac.[4] Mature females have a single functional ovary and two functional uteruses. Reproductive details vary among regions: off South Africa, the gestation period lasts approximately twelve months, with mating and birthing both occurring in late summer. The litters range from three to seven pups (average five) and the newborns are around 75–79 cm (30–31 in) long.[1][13] Off northern Australia, the gestation period lasts nine months, with birthing taking place in November and December. The litters range from six to thirteen pups (average nine) and the newborns are around 59–66 cm (23–26 in) long.[25]

Young sharks can be found in shallow inshore environments such as bays until at least three years of age, suggesting that this species uses these sheltered habitats as nurseries.[26] As the sharks grow older, they venture farther from land into deeper water more and more often, until they eventually disperse.[14][27] This is a long-lived, slow-growing species; males grow faster and reach a smaller ultimate size than females. Sexual maturity is attained at around 2.1 m (6.9 ft) long and twelve years of age for males, and 2.2 m (7.2 ft) long and thirteen years of age for females. The maximum lifespan is at least 26 years for males and 30 years for females.[25][28]

Human interactions [edit]

Large and formidably toothed, the pigeye shark is regarded as potentially dangerous to humans, though it has not been implicated in any attacks. This species is caught infrequently on longlines and in gillnets, and is used for meat and fins.[10] However, its flesh can cause ciguatera poisoning. In November 1993, some 500 people in Manakara, Madagascar were poisoned, 98 of them fatally, after eating meat from a pigeye shark. This was the first recorded mass ciguatera outbreak caused by a shark, as well as the first with a significant death toll.[29] The International Union for Conservation of Nature (IUCN) has listed the pigeye shark overall as Data Deficient, while noting that its rarity may render it susceptible to overfishing.[1] In KwaZulu-Natal, South Africa, small numbers of pigeye sharks are caught in shark nets set up to protect beaches. The catch rate and the average size of sharks caught both decreased between 1978 and 1998, leading to concerns that the local population may be depleted. Thus, the IUCN has given this species a regional assessment of Near Threatened in the southwestern Indian Ocean.[30]

References [edit]

  1. ^ a b c d Cliff, G. (2009). "Carcharhinus amboinensis". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. 
  2. ^ a b c d e f g h i Voigt, M.; Weber, D. (2011). Field Guide for Sharks of the Genus Carcharhinus. Verlag Dr. Friedrich Pfeil. pp. 47–49. ISBN 978-3-89937-132-1. 
  3. ^ Müller, J.; Henle, F.G.J. (1839). Systematische Beschreibung der Plagiostomen (volume 2). Veit und Comp. p. 40. 
  4. ^ a b c d e f g h i Compagno, L.J.V. (1984). Sharks of the World: An Annotated and Illustrated Catalogue of Shark Species Known to Date. Food and Agricultural Organization of the United Nations. pp. 462–463. ISBN 92-5-101384-5. 
  5. ^ Garrick, J.A.F. (1982). Sharks of the genus Carcharhinus. NOAA Technical Report, NMFS Circ. 445: 1–194.
  6. ^ Compagno, L.J.V. (1988). Sharks of the Order Carcharhiniformes. Princeton University Press. pp. 319–320. ISBN 0-691-08453-X. 
  7. ^ Vélez-Zuazoa, X.; Agnarsson, I. (February 2011). "Shark tales: A molecular species-level phylogeny of sharks (Selachimorpha, Chondrichthyes)". Molecular Phylogenetics and Evolution 58 (2): 207–217. doi:10.1016/j.ympev.2010.11.018. PMID 21129490. 
  8. ^ Naylor, G.J.; Caira, J.N.; Jensen, K.; Rosana, K.A.; Straube, N.; Lakner, C. (2012). "Elasmobranch phylogeny: A mitochondrial estimate based on 595 species". In Carrier, J.C.; Musick, J.A.; Heithaus, M.R., eds. The Biology of Sharks and Their Relatives (second ed.). CRC Press. pp. 31–57. ISBN 1-4398-3924-7. 
  9. ^ a b Tillett, B.J.; Meekan, M.G.; Broderick, D.; Field, I.C.; Cliff, G.; Ovenden, J.R. (2012). "Pleistocene isolation, secondary introgression and restricted contemporary gene flow in the pig-eye shark, Carcharhinus amboinensis across northern Australia". Conservation Genetics 13 (1): 99–115. doi:10.1007/s10592-011-0268-z. 
  10. ^ a b c d Last, P.R.; Stevens, J.D. (2009). Sharks and Rays of Australia (second ed.). Harvard University Press. pp. 253–254. ISBN 0-674-03411-2. 
  11. ^ McKay, R.J.; Beinssen, K. (1988). "Albinism in the pigeye whaler shark Carcharhinus amboinensis Mueller and Henle from Queensland Australia". Memoirs of the Queensland Museum 25 (2): 463–464. 
  12. ^ De Maddalena, A.; Della Rovere, G. (2005). "First record of the pigeye shark, Carcharhinus amboinensis (Muller & Henle, 1839), in the Mediterranean Sea". Annales Series Historia Naturalis 15 (2): 209–212. 
  13. ^ a b c d e Cliff, G.; Dudley, S.F.J. (1991). "Sharks caught in the protective gill nets off Natal, South Africa. 5. The Java shark Carcharhinus amboinensis (Muller & Henle)". South African Journal of Marine Science. Suppl. 11: 443–453. doi:10.2989/025776191784287817. 
  14. ^ a b Knip, D.M.; Heupel, M.R.; Simpfendorfer, C.A.; Tobin, A.J.; Moloney, J. (2011). "Ontogenetic shifts in movement and habitat use of juvenile pigeye sharks Carcharhinus amboinensis in a tropical nearshore region". Marine Ecology Progress Series 425: 233–246. doi:10.3354/meps09006. 
  15. ^ Knip, D.M.; Heupel, M.R.; Simpfendorfer, C.A.; Tobin, A.J.; Moloney, J. (2011). "Wet-season effects on the distribution of juvenile pigeye sharks, Carcharhinus amboinensis, in tropical nearshore waters". Marine and Freshwater Research 62 (6): 658–667. doi:10.1071/MF10136. 
  16. ^ Gleeson, R.J.; Bennett, M.B.; Adlard, R.D. (2010). "First taxonomic description of multivalvulidan myxosporean parasites from elasmobranchs: Kudoa hemiscylli n.sp. and Kudoa carcharhini n.sp. (Myxosporea: Multivalvulidae)". Parasitology 137 (13): 1885–1898. doi:10.1017/S0031182010000855. PMID 20619061. 
  17. ^ Henderson, A.C.; Reeve, A.J.; Tang, D. (2013). "Parasitic copepods from some northern Indian Ocean elasmobranchs". Marine Biodiversity Records 6: e44. doi:10.1017/S1755267213000195. 
  18. ^ a b Olson, P.D.; Caira, J.N.; Jensen, K.; Overstreet, R.M.; Palm, H.W.; Beveridge, I. (2010). "Evolution of the trypanorhynch tapeworms: parasite phylogeny supports independent lineages of sharks and rays". International Journal for Parasitology 40 (2): 223–242. doi:10.1016/j.ijpara.2009.07.012. PMID 19761769. 
  19. ^ Caira, J.N.; Mega, J.; Ruhnke, T.R. (2005). "An unusual blood sequestering tapeworm (Sanguilevator yearsleyi n. gen., n. sp.) from Borneo with description of Cathetocephalus resendezi n. sp from Mexico and molecular support for the recognition of the order Cathetocephalidea (Platyhelminthes: Eucestoda)". International Journal for Parasitology 35 (10): 1135–1152. doi:10.1016/j.ijpara.2005.03.014. PMID 16019004. 
  20. ^ Campbell, R.A.; Beveridge, I. (1987). "Floriceps minacanthus sp. nov. (Cestoda: Trypanorhyncha) from Australian fishes". Transactions of the Royal Society of South Australia 111 (3–4): 189–194. 
  21. ^ Palm, H.W.; Beveridge, I. (2002). "Tentaculariid cestodes of the order Trypanorhyncha (Platyhelminthes) from the Australian region". Records of the South Australian Museum 35 (1): 49–78. 
  22. ^ Schaeffner, B.C.; Beveridge, I. (2013). "Redescriptions and new records of species of Otobothrium Linton, 1890 (Cestoda: Trypanorhyncha)". Systematic Parasitology 84 (1): 17–55. doi:10.1007/s11230-012-9388-1. PMID 23263940. 
  23. ^ Knip, D.M.; Heupel, M.R.; Simpfendorfer, C.A. (2012). "Mortality rates for two shark species occupying a shared coastal environment". Fisheries Research. 125–126: 184–189. doi:10.1016/j.fishres.2012.02.023. 
  24. ^ Kinney, M.J.; Hussey, N.E.; Fisk, A.T.; Tobin, A.J.; Simpfendorfer, C.A. (2011). "Communal or competitive? Stable isotope analysis provides evidence of resource partitioning within a communal shark nursery". Marine Ecology Progress Series 439: 263–276. doi:10.3354/meps09327. 
  25. ^ a b Stevens, J.D.; McLoughlin, K.J. (1991). "Distribution, size and sex composition, reproductive biology and diet of sharks from northern Australia". Australian Journal of Marine and Freshwater Research 42 (2): 151–199. doi:10.1071/MF9910151. 
  26. ^ Knip, D.M.; Heupel, M.R.; Simpfendorfer, C.A. (2012). "Evaluating marine protected areas for the conservation of tropical coastal sharks". Biological Conservation 148 (1): 200–209. doi:10.1016/j.biocon.2012.01.008. 
  27. ^ Tillett, B.J.; Meekan, M.G.; Parry, D.; Munksgaard, N.; Field, I.C.; Thorburn, D.; Bradshaw, C.J. (2011). "Decoding fingerprints: elemental composition of vertebrae correlates to age-related habitat use in two morphologically similar sharks". Marine Ecology Progress Series 434: 133–142. doi:10.3354/meps09222. 
  28. ^ Tillett, B.J.; Meekan, M.G.; Field, I.C.; Hua, Q.; Bradshaw, C.J.A. (2011). "Similar life history traits in bull (Carcharhinus leucas) and pig-eye (C. amboinensis) sharks". Marine and Freshwater Research 62 (7): 850–860. doi:10.1071/MF10271. 
  29. ^ Habermehl, G.G.; Krebs, H.C.; Rasoanaivo, P.; Ramialiharisoa, A. (1994). "Severe ciguatera poisoning in Madagascar — a case-report". Toxicon 32 (12): 1539–1542. doi:10.1016/0041-0101(94)90312-3. PMID 7725322. 
  30. ^ Cliff, G. (2009). "Carcharhinus amboinensis (Southwest Indian Ocean subpopulation)". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!